Abstract

Introduction: Oxidative stress is a significant issue arising from the excessive production of oxidants by superoxide oxides and nitric oxides in our body, which leads to inflammation and tissue damage. In patients with inflammatory bowel disease (IBD), the immune system mistakenly identifies food as antigens, releasing various cytokines to combat this perceived threat and causing IBD symptoms. The loss of intestinal barrier integrity is directly linked to the severity of IBD. It results in a leaky gut, bacterial infiltration, and an increase in inflammatory cytokines. The immune system typically combats infections through the generation of various T- and B-lymphocytes, leading to an adaptive immune response.

Method: In this study, we evaluated the prophylactic effect of a novel combinatorial probiotic formulation, "ABT," in an IBD model in male BALB/c mice. 106 CFU of ABT was administered orally to the mice. Subsequently, 3% DSS was administered orally to induce colitis. Body weight loss was monitored, as it is one of the critical clinical symptoms of colitis. After sacrifice, various parameters were analyzed to validate the efficacy of the probiotic formulation.

Results: The formulation prevented the symptoms of colitis, oxidative stress, maintained colon length, and achieved a balance in the expression patterns of pro-inflammatory cytokines (iNOS, IFNg) with the junctional proteins mRNA expression (Claudin-1, ZO-1). Thus, our 3-strain novel formulation can prophylactically block the Th1 mediated pathway.

Conclusion: Our study concludes that the probiotic 3-strain "ABT," when administered prophylactically, prevented the Th1 mediated immune response and can be considered for use as a wellness health drink.

Introduction

Inflammatory bowel disease (IBD) is the umbrella term for Crohn's Disease (CD) and Ulcerative Colitis (UC), the two major forms of the disease. CD involves patchy inflammation throughout the intestinal layer and can occur in all layers of the intestine. In contrast, UC exclusively affects the innermost lining of the colon and creates continuous inflammation throughout the colon's lining1. IBD is associated with damaged barrier function in the intestinal epithelium. In healthy individuals, the intestinal epithelium maintains an intact and effective barrier function against pathogens. In IBD, compromised barrier function allows bacterial products to cross the mucosal barrier, alongside infiltration of pathogenic bacteria, igniting uncontrollable inflammatory signal cascades and leading to a classic adaptive immune response2.

The incidence and prevalence of inflammatory bowel disease are highest in Western countries, including the United States of America and the United Kingdom. Over the last decade, IBD has rapidly emerged in Eastern countries as well, narrowing the gap between the two regions with an increasing number of IBD cases in Eastern countries. Asia, notably China, has the highest incidence of IBD.

Various chemical agents play a critical role in mimicking human IBD. DSS (dextran sulfate sodium), TNBS (2, 4, 6-trinitrobenzene sulfonic acid), or Oxazolone act directly on the colonic epithelium, damaging the barrier integrity by infiltrating immune cells, thus accelerating and perpetuating ongoing inflammation. Tight junctions are crucial in regulating the barrier integrity throughout the intestinal epithelium. The mucous layer serves as a major defense system in the gut's intestinal epithelium, crucial for pathogen clearance and inhibition of pathogenic infection and inflammation. The mucous layer's thickness, evidenced by the presence of the highly glycosylated polymeric protein mucin, is decreased in DSS-induced disrupted intestinal epithelium. Inflammatory bowel disease alters the expression of certain tight junctional proteins like Claudin-1 and ZO-1, activating various inflammatory cascades and leading to colitis development3, 4. Activated phagocytic immune cells infiltrate the gut mucosal tissue, generating reactive oxygen species (ROS) and reactive nitrogen species (RNS)5, 6.

Recent evidence suggests the pivotal role of oxidative stress in the pathogenesis and tissue damage associated with IBD. Under normal physiological conditions, the healthy cells of the intestinal tissue layer tolerate ROS levels7. ROS acts as a secondary messenger, regulating cellular physiological processes, including maintaining endogenous homeostasis and biological functions such as redox signal transduction, gene expression, and receptor activation. These processes are beneficial for tissue turnover and cell proliferation7. Excessive generation of ROS enhances membrane permeability and lipid peroxidation in the plasma membrane of intestinal tissue, activating the intestinal immune system. This leads to damage to the intestinal mucosal barrier by reducing mucous secretion and damaging tight junctions, causing an imbalance of pro-oxidant and antioxidant entities, thus triggering inflammation. Oxidative stress leads to increased levels of inflammatory cytokines like TNF-α, IL-1β, and IFN-γ, enhancing the Th1 cell response8. This forms a vicious cycle of oxidative stress-ROS-inflammation-ROS-oxidative stress, presenting a potential target for treating DSS-induced colitis, alleviating oxidative stress, immune markers, and improving intestinal mucosal barrier9, 10.

Dextran sulfate sodium (DSS) is a toxic, water-soluble, negatively charged polysaccharide reagent with molecular weights ranging from 5 to 1400 kDa. Administering DSS to mice induces inflammation and degeneration in the intestinal tract, disrupting the intestinal epithelial monolayer and allowing luminal bacteria and their associated antigens into the mucosa, leading to the generation of pro-inflammatory cytokines. Despite the unclear pathophysiology of DSS-induced intestinal inflammation in IBD, its multi-mechanistic pathological cascade is linked to the disruption of the monolayer lining of the colon, recruiting inflammatory cells, and accelerating the excessive release of pro-inflammatory cytokines such as tumor necrosis factor-α (TNFα) and interleukin1-β (IL1β), leading to necrosis. Thus, the DSS-induced IBD model in research is relevant due to its simplicity and reproducibility in animal studies11.

As a cure, various antibiotics are used in treating IBD. Nitroimidazoles and fluoroquinolones, the two types of antibiotics with the highest IBD risk in the study, are commonly prescribed for gastrointestinal infections. For nitroimidazoles, the increased risk steadily climbs with age for those older than 60 years. With fluoroquinolones, the increased risk is primarily concentrated among people aged 40 to 60 years. Antibiotic exposure is associated with an increased risk of IBD recurrence after 2-3 months of use, mainly in individuals aged 40 years and older12. Moreover, recent work has shown that continual use of antibiotics to treat IBD can increase the effect of enterocolitis. The efficacy of current treatments is temporary, relieving symptomatic complications after a certain time. Excessive use of antibiotics damages the normal luminal microorganisms, allowing pathogenic bacteria to enter the gut, adhere, and grow on the intestinal layer13. Thus, there is a need for an alternative approach to treating colitis14.

A safer therapeutic alternative is offered by probiotics in treating IBD15. Probiotics are "live microorganisms that beneficially affect the host by improving the indigenous microflora's properties." Probiotics improve immune responses, regulate the gut microbiome, leading to better digestion, and prevent pathogenic infections. Commonly used probiotics include Lactobacillus sp., Bifidobacterium sp., Saccharomyces sp., and Streptococcus sp., effectively used alone or in combination as therapeutic agents in various chemically induced IBD disease models16, 17.

Recent advances in genetic engineering have led to the development of genetically engineered probiotic strains to act as "intestinal biosensors" (to detect inflammatory markers) or "intestinal biotherapeutics" (to improve drug delivery at the mucosal surface and directly release therapeutic substances into the intestinal lumen). Engineered probiotic strains are developed using plasmids as vectors, with exogenous DNA fragments containing genes for immunoregulatory cytokines and anti-inflammatory mediators inserted into the plasmids by restriction enzymes. This enables the recombinant probiotic strain to express these regulatory proteins18.

However, these advancements face challenges due to the limited knowledge of relevant biomarkers specific to gut inflammation. Most published studies have focused on developing engineered probiotics capable of expressing therapeutic molecules (biotherapeutic probiotics). These biotherapeutic probiotics are live bacteria designed to produce anti-inflammatory molecules in situ, offering the main advantage of releasing therapeutics at the inflammation sites. This direct in situ release maximizes therapeutic concentrations in the target tissue using relatively smaller doses of the therapeutic compound, thus limiting systemic side effects. Nonetheless, this approach has limitations, including the need for significant energy for the constitutive expression of these substances, increasing the risk of overproducing the therapeutic substance at unwanted sites and potentially impacting both effectiveness and safety18.

Several bioengineered techniques using Lactococcus lactis are being employed in IBD treatment. Trefoil factors (TFF) and anti-tumor necrosis factor-α (TNF-α) nanobodies (single-domain antibody fragments) have been constitutively expressed in L. lactis and tested for therapeutic effects in DSS-induced colitis in mice19. One study explored the use of L. lactis with the Microbial Anti-inflammatory Molecule (MAM)-encoding plasmid20. MAM, a peptide produced by Faecalibacterium prausnitzii, downregulates NF-κB expression in vitro. Another study used Bifidobacterium longum genetically modified to express the α-melanocyte-stimulating hormone (α-MSH)21. α-MSH is a tridecapeptide derived from pro-opiomelanocortin that exhibits potent anti-inflammatory properties by downregulating the release of proinflammatory cytokines and mediators, such as ILs, TNF-α, and NO, and upregulating the anti-inflammatory cytokine IL-1022. Although bioengineered probiotics have shown beneficial effects in preclinical mouse models, limitations persist in human applications. One main reason for these limitations is the difference in microbiota between mice and humans, potentially reducing the growth rate of genetically engineered bacteria due to differing environmental conditions18. Genetically engineered probiotics could struggle to achieve colonization due to the complexity of establishing a niche to survive in the gut microbiome.

Beyond bioengineering prospects, several studies have demonstrated the effectiveness of probiotics, such as fermented milk products, in reducing numerous infectious and inflammatory diseases23. Probiotic L. paracasei fermented milk reduced infections in the respiratory and gastrointestinal tracts of young children24. Lactobacillus strains like L. jensenii, L. reuteri, and L. casei have been shown to generate anti-inflammatory effects in mice by downregulating the activity of TNF-α, IFN-γ, and maintaining intestinal barrier integrity25. Various therapeutic studies have employed Lactobacillus vulgaricus and Streptococcus thermophilus, showing that both strains synergistically modulated IL-6, IFN-γ, and TNF-α secretion, while enhancing IL-2 and IL-4 expression, thereby regulating the Th1 immune response26. Generally, the three bacteria used in this study, labeled "A", "B", and "T", either separately or together, compete with pathogens and colonize the epithelium. They signal the repair of the leaky barrier by stabilizing the junctional proteins, upregulating mucus production, and downregulating inflammatory genes in the mucosa. This leads to reduced inflammatory mediators and ultimately tissue repair in a therapeutic condition. Probiotics exhibit diverse mechanisms of action, one of which includes a cytoprotective effect on gastric mucosa integrity by strengthening epithelial junctions and preserving mucosal barrier function27.

A literature review revealed that Bifidobacterium bifidum and Lactobacillus acidophilus, as singular strains, are widely studied and are the best probiotics to heal our gut. The prophylactic effect of either a single strain among "A", "B", and "T" or two strains among these ("A", "B", and "T") has been studied and found beneficial, with different species names used in those studies. The specific species used in this study to validate its prophylactic activity have not been studied earlier.

Thus, this study utilizes a novel probiotic formulation to prevent the development of inflammatory bowel disease. The novelty of our study lies in the synergistic use of three bacterial strains and their formulation in a proprietary blend. Our formulation, containing three probiotic bacteria named "A", "B", and "T" mixed in proprietary ratios, has efficiently proven to possess antimicrobial activity against various gut pathogenic bacteria through in vitro assays performed in our lab. We have now advanced this work to a pre-clinical mouse model to study the prophylactic activities of this novel combinatorial formulation against DSS-induced IBD15, 28.

Methods Preparation of Whey Water

Through in vitro viability assays, it was observed that, among the three-strain probiotic formulation, the "T" bacteria initiates growth, followed by "B" and "A". Through various in vitro biochemical assays, a specific combination, maintained in a proprietary ratio, has shown to have a more beneficial effect. Thus, an in vivo-based prophylactic study has been undertaken to study their efficacy. For culturing the probiotics in milk, a powdered culture containing "A", "B", and "T" together was added to pasteurized double-toned milk that had been boiled and cooled to room temperature. This mixture was then incubated overnight at 42°C. The whey water (ww) formed above the fermented milk (curd) was strained through a nylon mesh and collected in tubes (Figure 1). The shelf life of the probiotics in whey water was determined to be 120 hours as observed through an in vitro growth curve study. The active period of these 3-strain probiotics was maintained for better viability and consistency throughout the study.

× Figure 1 . Diagram showing the preparation of whey water by adding “A” “B” and “T” probiotic formulation powder in pasteurized double toned milk . Figure 1 . Diagram showing the preparation of whey water by adding “A” “B” and “T” probiotic formulation powder in pasteurized double toned milk . × Figure 2 . Diagrammatic representation of treatment regimen for DSS induced acute colitis in BALB/c mice . In diseased groups, 3% DSS treatment was administered on days 7, 10, 12 and 14. In the prophylactic groups, W1D group was administered 1.2 x 10 7 CFU/Kg probiotic formulation orally on days 0, 2, 4 and 6, and the W2D, 1.2 x 10 7 CFU/Kg probiotic formulation was administered orally on days 0, 2, 4, 6, 8, 10, 12 and 14. The mice were sacrificed on day 15. Figure 2 . Diagrammatic representation of treatment regimen for DSS induced acute colitis in BALB/c mice . In diseased groups, 3% DSS treatment was administered on days 7, 10, 12 and 14. In the prophylactic groups, W1D group was administered 1.2 x 10 7 CFU/Kg probiotic formulation orally on days 0, 2, 4 and 6, and the W2D, 1.2 x 10 7 CFU/Kg probiotic formulation was administered orally on days 0, 2, 4, 6, 8, 10, 12 and 14. The mice were sacrificed on day 15.

Table 1.

Protocol for cDNA synthesis

Temperature Time No. of cycles Purpose 42˚C 30 mins 1 cDNA synthesis 95˚C 2 mins Inactivation of enzymes

Table 2.

Protocol for PCR amplification

Temperature Time No. of cycle 95ºC 5 min 1 cycle 95ºC 45 sec 30 cycles TºC 30 sec 72ºC 45 sec 72ºC 10 min 1 cycle 4ºC Infinite

Table 3.

List of primers used for gene expression study by RT-PCR

Gene Primer sequences Tm (˚C) Product size GAPDH F 5’- GAGGGGCCATCCACAGTCTTC 3’ R 5’- CATCACCATCTTCCAGGAGCG 3’ 62.75 357bp Claudin 1 F 5’ AGGTCTGGCGACATTAGTGG 3’ R 5’ CGTGGTGTTGGGTAAGAGGT 3’ 59.35