Cell culture

HCC cells (Huh7 and MHCC-97 H) were procured from iCell Bioscience (Shanghai, China). These cells were cultured in Dulbecco’s modified Eagle’s medium (Servicebio, China) supplemented with 10% fetal bovine serum (Servicebio, China) and penicillin‒streptomycin solution (Servicebio, China). The cells were cultivated in a carbon dioxide cell incubator (Bluepard, China). The medium was replaced every 72 h (h), and the cells were passaged with trypsin (Servicebio, China).

Transfection

The control siRNA (siCtrl) and NETO2 siRNA (siNETO2) were procured from GenePharma (Shanghai, China). The siRNA sequences used were as follows (5’-3’): siCtrl (sense, UUCUCCGAACGUGUCACGUTT; antisense, ACGUGACACGUUCGGAGAATT), siNETO2-1 (sense, GGAGAUUCAUGUGGAUUAATT; antisense, UUAAUCCACAUGAAUCUCCTT), siNETO2-2 (sense, GACCUUUGAUGAACAUUAUTT; antisense, AUAAUGUUCAUCAAAGGUCTT) and siNETO2-3 (sense, GCAACAUGUGCAUCAAUAATT; antisense, UUAUUGAUGCACAUGUUGCTT). For transfection, cells were plated in a 6-well plate (3 × 105 cells/well) and divided into the blank, siCtrl, siNETO2-1, siNETO2-2, and siNETO2-3 groups. The blank group was cultivated as normal without transfection. The siCtrl, siNETO2-1, siNETO2-2, and siNETO2-3 groups were transfected with siCtrl, siNETO2, siNETO2-2, and siNETO2-3, respectively. Briefly, the siRNA (60 pmol) was added to 200 µL of serum-free medium, and then 10 µL of siRNA-mate (GenePharma, China) was added. The mixture was allowed to stand for 10 min at room temperature (RT) prior to being introduced into the cultured cells. At 48 h after transfection, Huh7 and MHCC-97 H cells were subsequently harvested for quantitative polymerase chain reaction (qPCR) to assess the efficiency of siRNA interference, and siNETO2-2 (re-named siNETO2 in the following experiments) was chosen for further experimentation.

In addition, the NETO2 overexpression (oeNETO2) and negative control overexpression (oeCtrl) plasmids were constructed by GenePharma (Shanghai, China). For transfection, cells were plated in a 6-well plate (3 × 105 cells/well) and divided into blank, oeCtrl, and oeNETO2 groups. The blank group was cultivated as normal without transfection. The oeCtrl and oeNETO2 groups were transfected with the oeCtrl or oeNETO2 plasmid. In brief, cells were cultured and transfected with 4 µg of plasmid using Lipofectamine 2000 (Thermo Fisher, USA). The cell medium was replaced after 6 h of treatment, and the cells were harvested for further experimentation after being cultured for an additional 48 h.

qPCR

After transfection, Huh7 and MHCC-97 H cells (1 × 106 cells) were incubated with 1 mL of TRIzol (Servicebio, China) for 5 min at RT. Then, 100 µL of RNA Extraction Buffer (Beyotime, China) was added, and the mixture was vortexed for 15 sections (s), followed by standing for 5 min. After centrifugation (12000 × g, 15 min), the supernatant fluid was carefully isolated and subsequently mixed with isopropanol (Hushi, China). After standing for 10 min, total RNA was collected after centrifugation and washing. After that, 1 ng of total RNA was added to reverse transcribed components (Servicebio, China) and incubated for 10 min at 65 °C. The cDNA template and the components of the qPCR mixture (Servicebio, China) were mixed, and a further qPCR program was carried out. The primers used were as follows (5’-3’): NETO2 (forward: TGCTCGGTCCTCAAAGTGTT, reverse: CCAAATGCCACACTGGGTTG) and GAPDH (forward: GAAAGCCTGCCGGTGACTAA, reverse: GCCCAATACGACCAAATCAGAGA).

Western blotting

After transfection, Huh7 and MHCC-97 H cells (5 × 106 cells) were lysed with 250 µL of RIPA buffer (Servicebio, China) supplemented with protease inhibitor (Servicebio, China). After 20 min of incubation, the lysate was centrifuged (10000 g, 10 min), which enabled the collection of the protein-containing supernatant. The protein concentration was assessed via a Bicinchonic Acid Kit (Servicebio, China). The proteins were subsequently separated via electrophoresis and transferred to nitrocellulose membranes. The membranes were blocked and incubated with primary antibodies against NETO2, p-STAT3, STAT3, C-MYC (Proteintech, China), and GAPDH (Servicebio, China). These membranes were subsequently incubated with secondary antibodies (Servicebio, China). Finally, the blots were visualized via Super ECL Reagent (Servicebio, China).

5-Ethynyl-2’-deoxyuridine (EdU) staining

After transfection, Huh7 and MHCC-97 H cells were plated into 24-well plates (6 × 104 cells/well) for 24 h. An EdU working solution (Servicebio, China) was prepared and added to the cells (10 µM) for 2 h. Subsequently, the cells were washed and blocked, followed by incubation with the Click additive solution (Servicebio, China) for 30 min at RT. Nuclei were visualized through 4’,6-diamidino-2-phenylindole (DAPI) (Beyotime, China) staining. Finally, photos were taken via a fluorescence microscope (Motic, China).

Cell counting Kit-8 (CCK-8) assay

Following transfection, Huh7 and MHCC-97 H cells were plated in 96-well plates (3 × 103 cells/well). After being cultivated for 24 h, 10 µL of CCK-8 solution (Seivicebio, China) was added to each well for 2 h. Subsequently, the optical density (OD) value was read via a microplate reader (Huadong Electronics, China).

Terminal-deoxynucleotidyl transferase-mediated Nick-End labeling (TUNEL)

After transfection, Huh7 and MHCC-97 H cells were dispensed into 24-well plates (6 × 104 cells/well). After a 24-h period of cultivation, the cells were washed and fixed with paraformaldehyde (Servicebio, China) and then stained with TUNEL staining solution (Servicebio, China) for 1 h at RT. Subsequently, DAPI staining was performed, and photos were taken.

Transwell invasion assay

Transwell assays were conducted to measure the invasive potential of Huh7 and MHCC-97 H cells post transfection. First, the cells were cultured without serum for 12 h and then plated in a Transwell insert (Corning, USA). Standard medium was added to the lower chamber. Following 24 h of incubation, invasive cells that migrated through the membrane were visualized via crystal violet (Servicebio, China) staining.

Cell scratch assay

Cell migration after transfection was assessed with a cell scratch assay. In brief, Huh7 and MHCC-97 H cells were seeded into 6-well plates (3 × 105 cells/well) and allowed to proliferate until they reached over 90% confluence. The scratches were produced via a pipette tip and photographed (designated the 0 h timepoint). After being cultured for 24 h without serum, the scratches were photographed at the same location (designated the 24 h timepoint).

Analysis of data from The Cancer Genome Atlas (TCGA).

An in-depth analysis of HCC data sourced from the TCGA via the University of Alabama at the Birmingham Cancer Data Analysis Portal (UALCAN) (https://ualcan.path.uab.edu/) and the Gene Expression Profiling Interactive Analysis (GEPIA) (http://gepia.cancer-pku.cn/) online tools, including NETO2 expression in HCC compared with normal controls, NETO2 expression across various stages of tumors, and the potential association of NETO2 expression with overall survival, was performed.

Statistical analysis

One-way analysis of variance (ANOVA) with Tukey’s test was used to compare the differences among groups. Statistical analyses were conducted via GraphPad 9.0 software (GraphPad, USA). A P value < 0.05 was considered significant.