Cell lines

Human gastric cancer cells AGS, HGC27, BGC823 and NCI-N87 was cultured in RPMI 1640 medium (HyClone), with 10% fetal bovine serum (FBS, Gibco) and 0.1% Penicillin/Streptomycin (P/S, TBD, PS2004HY), obtained from Procell (Wu Han, China). The cells were placed in a humidified incubator with 5% CO2 at 37 °C.

Genome-wide CRISPR/Cas9 activation screen

The genome wide CRISPR/Cas9 SAM lentiviral library (Addgene plasmid #1,000,000,078), containing 70,290 unique sgRNA sequences targeting 23,430 human genes, was introduced into AGS cells by lentiviral transduction as previously described [12]. For SAM gain-of-function screening, this gRNA library must be combined with 1 additional SAM construct MS2-P65-HSF1 (Addgene plasmid #89,308), selected with hygromycin B (YEASEN, 60225ES03). The AGS cells used for pooled SAM human lentiviral library transduction should stably expressing MS2-P65-HSF1. Then, at least 1 × 108 AGS cells were transduced with pooled SAM lentiviral library at a low MOI (~ 0.5). Lastly, the transduced cells were selected with blasticidin (MDBio, D0120601) for 10 days to generate a mutant cell pool. Cells stably expressing SAM gRNAs library were cultured with 10 μg/mL apatinib (Hengrui Pharmaceutical Co., Ltd.) for two rounds. Before starting the next round of treatment, cells were allowed to grow to fusion and resistant cells were collected for genomic DNA extraction.

Genomic DNA extraction and sgRNA deep sequencing

The HiPure Tissue DNA Mini Kits (Magen) were used to extract genomic DNA. Amplification of the sgRNA sequences of each sample from the extracted genomic DNA using the CRISPRa-F: TCTTGTGGAAAGGACGAAACACCG and CRISPRa-R: CTCCTTTCAAGACCTAGGATC primers [12, 13]. The pooled PCR products were gel purified using the QiaQuick kit (Qiagen). The sgRNA abundance in the pooled resistant cells was detected by Illumina deep sequencing (Novogene Technology, China).

Establishment of candidate genes overexpression GC cells

The candidate genes MCM2, CCND3, ESPL1, PLK1, TCF7, PRICKLE1 and VANGL1 were selected for validation.The sgRNA plasmids of the candidate genes were synthesized(GENEROL BIOL) and used for GC cells transfection. Lentivirus was produced in 293 T cells and 9 µg sgRNA plasmid, 3 µg pCMV-VSVG plasmid, 3 µg pMDLg pRRE plasmid and 3 µg pRSV-Rev plasmid were used. The AGS and HGC27 cells were transfected with the sgRNA lentivirus. Then, the cells were selected with blasticidin (MDBio, D0120601).

shRNA and siRNA transfection

AGS or HGC27 cells were seeded in 6-well plates and transient transfection with ESPL1 shRNA (Table 1) or MDM2 siRNA (Table 2) when the cells reached 60% confluency. Briefly, 6μL shRNA or siRNA was pre-mixed with 100μL Opti-MEM (Gibco). Then, 8µL Lipo8000 transfection reagent (Beyotime, C0533) was added into 100 Opti-MEM and dropped into the plasmid mixture. The complex were incubated for 20 min at room temperature and then added to AGS or HGC27 cell culture. Transfection media was removed 5 h later and replaced with RPMI 1640 complete medium. The shRNA and siRNA were obtained from GENERAL BIOL (Chuzhou, China).

Table 1 The shRNA sequencesTable 2 The siRNA targeting sequencesReal-time quantitative reverse transcriptase PCR

The MCM2, CCND3, ESPL1, PLK1, TCF7, PRICKLE1 and VANGL1 mRNA levels were detected by real-time quantitative reverse transcriptase PCR (q-PCR) as previously described [12]. The PCR primers used were shown in Table 3.

Table 3 Primers sequences for q-PCRCell proliferation assay

The effect of apatinib (10 μg/mL, 48 h) on cells transfected with MCM2, CCND3, ESPL1, PLK1, TCF7, PRICKLE1 and VANGL1 overexpression plasmids was detected by CCK-8 assays (Beyotime, C0039) according to the manufacturer’s instructions. AGS-NC, AGS-ESPL1, AGS-shNC, AGS-shESPL1 cells were seeded in 96-well plates and treated with apatinib at the concentration of 0, 1, 10, 40 μg/mL for 48 h before running assay. Cell growth inhibition rate was then calculated based on the absorbance.

Migration Assay

The transwell (Corning) migration assay was used to detect the effect of apatinib (10 μg/mL, 48 h) on cells transfected with MCM2, CCND3, ESPL1, PLK1, TCF7, PRICKLE1 and VANGL1 overexpression plasmids as previously described [13].

Apoptosis assay

Cell apoptosis was conducted after treatment with10μg/mL apatinib or DMSO vehicle for 48 h using APC-conjugated Annexin V (Annexin V-APC) and 7-aminoactinomycin D (7-AAD) (Multisciences, AP104-100) according to manufacturers’ protocols. Fluorescence was measured using a BD FACS Calibur flow cytometer (Beckman) and data were analyzed by FlowJo software (FlowJo).

Western Blot analysis

The expression of ESPL1 (Santa, sc-390314), MDM2 (Santa, sc-965), Phospho-pan-AKT1/2/3 (affbiotech, AF0016), VEGF (HUABIO, ET1604-28), BCL-2 (Proteintech, 12,789–1-AP) protein was detected by western blot as previously described [13]. GAPDH (Proteintech, HRP-60004) was used as an internal reference.

Co-immunoprecipitation assay

Co-Immunoprecipitation (Co-IP) was used to detect the protein interactions. Firstly, the AGS cells are prepared and lysated with 200ul RIPA buffer (Beyotime, P0013B). Protein A/G MagBeads (GenScript, L00277) were incubated with ESPL1 (Santa, sc-390314) and MDM2 (Santa, sc-965) antibodies overnight, respectively. Then the MagBeads-antibody complexes were washed with 500ul IP Buffer for 3 times and incubated with cell lysates overnight to capture its direct interacting partners. Finally, MagBeads–antibody–protein complexes are precipitated and analyzed by Western Blot.

TCGA data analysis

For gastric cancer (Stomach adenocarcinoma, STAD) samples in TCGA, mRNA seq were retrieved and convert FPKM data to TPM. Finally, the mRNA expression level of MCM2, CCND3, ESPL1, PLK1, TCF7, PRICKLE1 and VANGL1 in 380 cancers and 37 paracancerous samples were analysized.

Drug susceptibility analysis

RNA-sequencing expression profiles and corresponding clinical information for STAD were downloaded from the TCGA dataset. The samples were devided into low and high expression group according to the median of ESPL1 mRNA levels. The chemotherapeutic response for each sample was predicted by R package “pRRophetic” based on the Genomics of Drug Sensitivity in Cancer (GDSC, https://www.cancerrxgene.org). The samples' half-maximal inhibitory concentration (IC50) was estimated by ridge regression. All parameters were set as the default values. Using the batch effect of combat and tissue type of all tissues, and the duplicate gene expression was summarized as mean value.

sgRNA-Seq data analysis

After the resistant cells was pooled to detect the sgRNA abundance by Illumina deep sequencing. The R software package (DESeq2) was then applied to perform a statistical analysis of the sequencing data as was shown in Additional file 2: Table S1. KEGG pathway enrichment analysis for DEGs were performed with R package topGO (v2.44.0). KEGG pathway with P value < 0.05 were considered as significantly enriched. The normalized expression matrix from DESeq2 was further centered and scaled by scale function and then visualized by R package pheatmap (v1.0.12).