Abstract

Introduction: The acquisition of human mesenchymal stromal/stem cells (hMSCs) is imperative for therapeutic interventions. These versatile cells can be sourced from various fetal tissues often regarded as medical waste post-delivery. Fetal hMSCs are also procurable from aborted fetuses during the initial and early second trimesters, and amniotic fluid (hAF-MSCs) secured through amniocentesis aimed at prenatal diagnostics. This study endeavors to evaluate two economical strategies for isolating hAF-MSCs: the one-step and the two-step method, emphasizing their efficiency and potential applications in cell therapy and regenerative medicine.

Method: The comparative analysis entailed isolating hAF-MSCs using both one-step and two-step techniques. Subsequent assessment of the derived cells involved flow cytometry to detect MSC markers (CD44, CD90, and CD105) and to ascertain their capability for adipogenic and osteogenic differentiation. This methodical approach enabled an evaluation of the effectiveness of each technique in deriving a homogeneous population of hAF-MSCs suited for therapeutic applications.

Results: Examination revealed that the amniotic fluid harbors various stem/progenitor cell subpopulations characterized by distinct adhesion properties. The two-step method proved superior in deriving hAF-MSCs, especially evident in the expansion of slowly adhering amniocytes into a more uniform population of hAF-MSCs. Interestingly, prior literature scarcely addresses the adhesion characteristics of hAF-MSCs, underscoring a novel aspect of our findings.

Conclusion: This study's outcomes highlight the two-step method as a more efficacious approach for isolating hAF-MSCs, suggesting the importance of considering cell adhesion properties during isolation processes. While additional research is necessary to fully understand the efficiency of cell adhesion in the derivation of hMSCs from various sources, these initial findings pave the way for advancements in regenerative medicine and cell therapy, proposing novel considerations for optimized hMSC isolation techniques.

Introduction

Recent advancements in regenerative medicine have led to a continuous search for reliable and safe sources of stem cells with therapeutic potential. Since the first description of human mesenchymal stromal/stem cells (hMSCs) derived from bone marrow (BM)1, these cells have been considered a prominent option for cell therapy. They are easy to use in human clinical trials, banking, and cryopreservation, and possess intrinsic features such as immunosuppressive properties, low immunogenicity, homing, and differentiation capability2, 3. In addition to adult tissues like BM and adipose tissue (AT)4, hMSCs have been found in various fetal sources, including the placenta (Pl), umbilical cord (UC), and cord blood (CB), as well as in various fetal tissues such as the spleen, lung, pancreas, and kidneys5, 6, 7.

While hematopoietic stem cells (HSCs) can be accessed through an “isolation” process, obtaining hMSCs for cell therapy involves a time-consuming ex vivo expansion process known as "derivation," which varies depending on the tissue source and can impact the success of the derivation process. The source of hMSCs also plays a significant role in determining their regenerative properties8. Fetal tissues are richer in hMSCs compared to adults and can be easily obtained from normally discarded fetal and extra-fetal tissues at birth, such as the umbilical cord, cord blood, placenta, amnion, and amniotic fluid9, 10. Studies have shown that fetal sources of hMSCs have substantial advantages over adult sources in terms of regenerative capabilities. Fetal/neonatal hMSCs have been found to possess a higher anti-inflammatory and immunosuppressive capacity, advanced homing ability, and more efficient plasticity and potency, making them strong candidates for the future of regenerative medicine11, 12, 13, 14.

Amniotic fluid (AF) is an intriguing source of fetal stem cells because it is situated near various tissues in the developing fetus, including the skin, respiratory, digestive, and urogenital tracts, as well as the amnion15, 16. During the second trimester of gestation, AF is obtained through amniocentesis, a procedure commonly used in prenatal diagnosis (PND)17. The cells within the AF, known as amniocytes, comprise a diverse group of stem cells and differentiated cells derived from the three germ layers: endoderm, mesoderm, and ectoderm18. Since the amnion develops directly from the epiblast layer, it is believed that AF may contain pluripotent stem cells originating from epiblast stem cells during the pre-gastrulation period19, 20. Consequently, various clonal amniocytes can form different morphological colonies in primary and long-term cultures21, 22, 23. While some authors refer to c-Kit+ cells as amniotic fluid stem cells (AFSCs), others describe clonal amniocytes as human amniotic fluid-derived MSCs (hAF-MSCs)24, 25.

Amniotic clones exhibit various responses to long-term culture. These differences are primarily due to the cellular content of AF, the genetic background of the individuals, and the gestational age26. Additionally, the method used to isolate the AFSC populations can impact their self-renewal capacities, growth rates, and differentiation ability27. There are several methods available for isolating AFSCs, as discussed by Klemmt and colleagues27. These methods include four main cultivation techniques: two based on the propagation of enriched amniocytes pelleted by centrifugation, including one-step and two-step culture methods; the third is the starter cell culture method, which is a short-term clonal expansion approach used to isolate the fibroblastic-like cell colonies physically; and the last involves an immunosorbent approach based on surface marker selection by antigen-antibody interaction, for instance, isolation of CD117+25 and CD133+ cells28.

Previous studies have shown that the method used to isolate and culture amniocytes can significantly affect their physical characteristics and surface markers21, 27. The cost-effectiveness of the isolation method is also important, especially for animal model studies. For example, the third and fourth culture methods are not cost-effective due to the need for highly experienced personnel and expensive laboratory processes, respectively. With the presence of various subpopulations of stem/progenitor cells in the amniotic fluid exhibiting different levels of adhesion, it raises the question of whether cell adhesion influences the efficiency of hMSCs' derivation. In our research, we explored two methods for obtaining a homogeneous population of hAF-MSCs without disrupting prenatal diagnosis procedures. The two methods we studied involved using amniocytes that either quickly attach to the culture dish in a one-step process or slowly attach in a two-step process.

Methods Culture Methods

The Ethical Committee of Yazd Reproductive Sciences Institute approved the study under the permission number "IR.SSU.REC.1396.169". Accordingly, three AF samples were collected from patients who had signed the consent form. The samples were collected from pregnant women aged 28 to 32 in their second trimester (16-18 weeks of pregnancy) for routine screening of fetal chromosomal abnormalities. The PND (prenatal diagnosis) results indicated that the samples had normal 46, XY karyotypes (male fetuses). It's important to note that high-risk pregnancies and lifestyle-related issues were excluded from the study, including tobacco, alcohol, and drug abuse, as well as pregnancy-related diseases such as history of miscarriage, gestational diabetes, and preeclampsia. We collected 16 ml of AF samples, centrifuged them at 400 g for 15 minutes, discarded the supernatant, and seeded the cell pellets in two glass Leighton tubes using AmnioMAX-II complete medium supplemented with 20 mM HEPES, 1% penicillin-streptomycin (Pen-Strep), and incubated them at 37°C and 5% CO2. The primary culture medium was refreshed on the 7th day for the first time, and then the primary cultures were subcultured after 12 to 14 days. Two days following the first passage, the cells were harvested for chromosomal analysis and concluded the PND process.

One-step method

It has been reported that amniocentesis procedures can potentially cause miscarriage (approximately 0.25%–0.50%). Therefore, it is necessary to have a valid medical reason for collecting human amniocytes, and the use of these cells for research should not interfere with the prenatal diagnostic process. In our case, the remaining Leighton tubes from the diagnostic process were utilized to derive hAF-MSCs using a one-step method. For this, the cells were cultured sequentially at a density of 104 cells/cm2 in a T25 flask and incubated at 37°C and 5% CO2. For this purpose, a modified medium composed of 2:1 v/v DMEM/AmnioMAX-II was used since our previous study had shown its higher efficiency compared to the DMEM and AmnioMAX-II alone21. The DMEM was supplemented with 4 mM L-glutamine, 10 mM HEPES, 15% fetal bovine serum (FBS), and 1% Pen-Strep (all from Gibco).

Two-step method

Human amniocytes have varying adhesive properties, making it difficult for many cells to attach to the surface of culture dishes during primary cultivation. The non-adherent cells, which are typically discarded during the first medium-refreshing step on the 7th day of cultivation, were utilized to derive hAF-MSCs through a two-step method without interfering with the PND process. However, the number of these cells is generally limited because they are removed from the primary culture without undergoing cell expansion (1-3 × 105 cells in each glass Leighton tube). They were collected by centrifugation, then seeded at a density of 103 cells/cm2 into a 6-well plate (about 104 cells per well) using a modified DMEM-AmnioMAX-II medium (2:1 v/v) supplemented in the same way as the one-step method. The clones from each well were seeded at a density of 104 cells/cm2 in a T25 flask using the same modified medium. The cell expansion process was common to both methods and continued until the third passage when the cells were harvested for flow cytometry analysis and culturing under differentiation conditions. The cells were subcultured at a confluence of 70-80% by washing with phosphate-buffered saline (PBS), treated with 0.05% Trypsin-EDTA (Gibco), and deactivated with the same volume of modified medium. The cultures were incubated at 37°C and under 5% humidified CO2 in both methods. A detailed schematic illustration of the culture methods can be found in Figure 1.

Molecular analysis

To assess the pluripotency of cells isolated by two different methods, we conducted a qualitative analysis using RT-PCR to examine a panel of stemness markers, including OCT4, NANOG, SOX2, C-KIT (CD117), C-MYC, and THY1 (CD90). The thermal cycling for gene amplification was carried out in Applied Biosystems thermal cyclers (VeritiPro™) with the following protocol: an initial holding stage at 94°C for 5 minutes, followed by 35 cycles of 94°C for 20 seconds, 58°C for 30 seconds, and 72°C for 1 minute. The final stage involved holding at 72°C for 7 minutes. Subsequently, the PCR products were separated on a 2% agarose gel stained with a fluorescent dye (DNA Green Viewer) and visualized using a UV Gel Doc system. Additionally, we used RT-PCR to quantitatively assess the expression of specific differentiation markers, such as peroxisome proliferator-activated receptor gamma (PPARγ) for adipogenic differentiation and runt-related transcription factor 2 (RUNX2) for osteogenic differentiation. The 18S rRNA served as the reference gene for quantitative analysis. To achieve this, we isolated total RNA from the cells cultured under differentiation conditions (after 21 days) using the Qiagen RNeasy™ Mini Kit according to the manufacturer's manual. Next, the extracted RNA (normalized to 200ng) was utilized to synthesize cDNA with the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) following the manufacturer's protocols. Quantitative RT-PCR analysis was performed using the Applied Biosystems StepOnePlus Real-Time PCR System, which involved an initial denaturation step at 95°C for 10 minutes, followed by 40 cycles of 95°C for 10 seconds and 60°C for 40 seconds. We employed the Applied Biosystems® SYBR® Green PCR Master Mix for the PCR reactions, and human-specific, intron-spanning primers were designed for the gene targets listed in Table 1.

× Figure 1 . The schematic illustration of culture methods . Protocol A : one-step method; Protocol B : two-step method. Figure 1 . The schematic illustration of culture methods . Protocol A : one-step method; Protocol B : two-step method.

Table 1.

The primers were designed for RT-PCR analysis of target genes

Gene Primer Product Size (base pairs) OCT4 Forward: GATGTGGTCCGAGTGTGGTT 245 bp Reverse: AGAGTGGTGACGGAGACAGG NANOG Forward: TTTGGAAGCTGCTGGGGAAG 194 bp Reverse: GATGGGAGGAGGGGAGAGGA SOX2 Forward: GCCGAGTGGAAACTTTTGTCG 154 bp Reverse: GCAGCGTGTACTTATCCTTCTT C-MYC Forward: TGGTCGCCCTCCTATGTTG 151 bp Reverse: CCGGGTCGCAGATGAAACTC C-KIT Forward: CCAACACCGGCAAATACACG 250 bp Reverse: TTGATCATGATGCCCGCCTT THY1 Forward: TCAGCATCGCTCTCCTGCTA 120 bp Reverse: TGCTGGTATTCTCATGGCGG PPARγ Forward: TTATTCTCAGTGGAGACCGCC 110 bp Reverse: CTCAGGGTGGTTCAGCTTCA RUNX2 Forward: GCGCATTCCTCATCCCAGTAT 120 bp Reverse: TGCCTGGGGTCTGTAATCTG 18s rRNA Forward: AGAAACGGCTACCACATCCA