Clinical samples

A total of 120 liver cancer tissue samples were obtained after informed consent was obtained from patients who underwent liver resection at the Western China Hospital of Sichuan University from 2018 to 2019. The study was conducted in accordance with the Declaration of Helsinki and the protocols were approved by the Ethics Committee of the Western China Hospital of Sichuan University (2016-91). All subjects provided informed consent for inclusion before participating in the study, and the tissue was used for future studies.

Analysis of the dataset

The expression of NPC1 in various cancer types was obtained from the UALCAN, TIMER, and Oncomine Datasets. NPC1 expression data in liver cancer tumors and adjacent tissues were collected from the HCCDB15 and HCCDB18 databases. Survival data were also obtained from these databases, along with Kaplan-Meier plotter data. The pathway activity scores were obtained from the GSCA database.

Cell lines and reagents

The liver cancer cell lines Huh7 and HepG2 were purchased from Procell Life Sciences and Technology (Wuhan, China). liver cancer cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Grand Island, NY, USA) supplemented with fetal bovine serum (FBS; Gibco) at 37 °C, 5% CO2.

Construction of cell lines with stable knockdown of NPC1

Huh7 and HepG2 cells stably knocked down for NPC1 were generated using interference plasmids. The target sequences were sh-NPC1-1 AGAGGTACAATTGCGAATATT, sh-NPC1-2 ACTCCTACATGGTGGATTATT, sh-NPC1-3 GTCCTGGATCGACGATTATTT. The target sequences of shNPC1 were individually constructed on the pPB[shRNA]-EGFP: T2A: Pu plasmid. According to the protocol, OPTI-MEM (400 µl), PiggyBac transposon plasmid (2 µg), pBase expression plasmid (2 µg), and X-treme GENE HP DNA Transfection Reagent (12 µl) were used for transfecting liver cancer cells. After 72 h, the medium was replaced with fresh culture medium containing puromycin (2 µg/ml), and the cells were further cultured. The puromycin selection medium at a concentration of 2 µg/mL was replaced every 2–3 days based on the growth status of the cells. Cell survival was observed under a microscope, and EGFP expression was observed under a fluorescence microscope. After approximately 10 days of culturing, individual resistant colonies were observed. Single-cell clone selection was performed, and the cells were further cultured for expansion. Stable interference in the cell lines was verified by RT-qPCR and Western blotting. The verified cells were cultured in puromycin selection medium at a concentration of 1 µg/ml.

Cell proliferation assay

Cell proliferation was measured using the Cell Counting Kit-8 (CCK-8; BIMAKE, Houston, Texas, USA). 2 × 103 cells were seeded into a 96-well plate per well with 3 duplications, followed by incubation for 1 h at 37 °C. The absorbance was measured at 450 nm daily for three consecutive days. For the colony formation assay, 2 × 103 treated cells were coated onto 6-well plates in triplicate. After 14-day incubation, the plates were washed twice with phosphate buffered saline (PBS) twice, fixed with 4% formaldehyde for 10 min, and stained with 0.1% crystal violet solution (Cat#G1064, Solarbio) within 10 min for further analysis. Relative colony area was calculated as the proportion of pixels occupied by the purple colony, determined using Photoshop CS5. For direct observation of proliferating cells, a 5-Ethynyl-2-deoxyuridine (Edu) incorporation experiment was performed according to the manufacturer’s specifications. Each experiment was repeated at least three times. The mean for each condition is the average of the biological replicates.

Transwell invasion/migration assay

Transwell invasion and migration assays were performed using BioCoat Matrigel Invasion Chamber, Cell Culture Inserts, and Control Inserts (Corning) in accordance with the manufacturer’s protocols. For invasion/migration assay, 4 × 104 to 105 cells were seeded into the insert chambers and cultured at 37 °C for 24 h. The membranes of the insert chambers were fixed with 4% formaldehyde for 10 min and stained with a 0.1% crystal violet solution.

Wound healing assay

4 × 106 Cells were seeded in 6 cm culture dishes. After 24 h, the cells covered the surface. The DMEM medium containing 1 µg/ml mitomycin C (MCE, Shanghai, China) was prepared, and after treating the cells with this medium for 1 h, vertical lines were drawn on the dish using a 1 ml pipette tip. The medium was aspirated, and the cells were washed 2–3 times with PBS before taking microscope images. After 24 h, images were taken again.

Flow cytometry

Cells were digested using trypsin without EDTA. After digestion was stopped, the cells were collected by centrifugation (400 g for 5 min). The cells were washed once with PBS and then collected again by centrifugation. The cells were stained according to the instructions of the Annexin V-FITC/PI apoptosis detection kit (4 A BIOTECH, Suzhou, China) and then analyzed by flow cytometry.

Real-time quantitative PCR(qPCR)

Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) was then subjected to cDNA synthesis using Prime ScriptTM RT reagent Kit (Takara, Japan). MiRNA was extracted and purified with miRNeasy® Mini kit (Hilden, Germany) according to the manufacturer’s instructions. ACTB and NPC1 quantitative PCR primers were synthesized from Tsingke Biotechnology (Beijing, China). All the primer sequences are listed in Table S1. The expression of selected genes was determined in triplicate using LightCycler®96 (Roche, Rotkreuz, Switzerland). The relative fold changes were calculated by 2−ΔΔCT method.

Western blotting

Cell lysates were extracted using RIPA buffer (Cell Signaling Technology, Danvers, Massachusetts, USA). For cytoplasm-nucleus fraction assay, the cell lysates were extracted separately from cells using NE-PER Nuclear and Cytoplasmic Extraction Reagents 78,833 (Thermo Scientific, Massachusetts, USA). The following primary antibodies were used for western blotting: anti-β-catenin monoclonal, 9562s (Cell Signaling Technology); anti-NPC1 polyclonal, 13926-1-AP(Proteintech, Chicago, USA); anti-N-cadherin polyclonal, 13116s (Cell Signaling Technology); anti-c-myc polyclonal, 10828-1-AP(Proteintech, Chicago, USA); anti-CyclinD1 monoclonal, 92G2(Cell Signaling Technology); anti-E-cadherin monoclonal, 3195s(Cell Signaling Technology); anti-vimentin monoclonal, 5741s(Cell Signaling Technology); anti-histone H3-polyclonal, 9715s (Cell Signaling Technology); and anti-β-actin monoclonal (Zsbio, Beijing, China). Immune complexes were visualized using enhanced chemiluminescence detection reagents (4 A BIOTECH, Beijing, China).

IHC staining and score

Anti-NPC1 polyclonal, 13926-1-AP(Proteintech, Chicago, USA); anti-Ki67 monoclonal, ab16667 (Abcam); anti-E-cadherin monoclonal, 3195s(Cell Signaling Technology); anti-N-cadherin polyclonal, 13116s (Cell Signaling Technology) and anti-vimentin monoclonal, 5741s(Cell Signaling Technology) were used for IHC staining. IHC staining images were obtained using Olympus BX63 microscope. For scoring NPC1 IHC staining of HCC patient specimens, Staining Intensity Score: No staining is 0 points, light yellow is 1 point, brownish-yellow is 2 points, and brown is 3 points. Proportion of Positive Cells Score: A positive cell proportion of 0–10% is 0 points, 11–25% is 1 point, 26–50% is 2 points, 51–75% is 3 points, and a positive cell proportion of ≥ 76% is 4 points. The sum of the staining intensity score and the proportion of positive cells score is the immunohistochemical score.

Dual-luciferase assay

To monitor the activity of the Wnt/β-catenin signaling pathway in cultured cells, pGL4.49, which contains a T-cell-specific transcription factor (TCF)-lymphoid enhancer-binding factor (LEF) response element and the pRL Renilla Luciferase Control Reporter Vector pRL-TK, was purchased from Promega Co.(Madison, WI, USA). pGL4.49 was transfected using Lipofectamine 3000 into liver cancer cells growing to 70% confluence along with pRL-TK. At 48 h post-transfection, cell lysates were collected and luciferase activity was measured using the Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer’s protocol. Luciferase activity of pRL-TK was used as an internal control.

Immunofluorescence staining and confocal microscopy

The cells were grown on sterile coverslips in a 6-well plate. When the cells reached 70% confluence, they were fixed with 4% paraformaldehyde for 15 min at room temperature and permeabilized with 0.5% TritonX-100 for 10 min. After blocking with 3% BSA for30 minutes, cells were incubated with the primary β-catenin antibody, 1:100 dilution) for overnight at 4 °C. The cells were then incubated with Alexa Fluor® 488 conjugated goat anti-mouse secondary antibody at a 1:1,000 dilution for 1.5 h at room temperature in the dark. DAPI staining of cell nuclei was performed. The cells were visualized using. Images were acquired at a magnification of 200×.

Animal study

Male nude mice were purchased from GemPharmatech Co. Ltd. (Nanjing, China). Mice were housed under specific pathogen-free conditions with a 12-h light/dark cycle and provided ad libitum access to tap water and food. Huh7 cells (106 cells) were resuspended in 200 µL of a 1:1 DMEM: Matrigel (Corning, BD Biosciences) mixture and subcutaneously injected into 4- to 6-week-old NCG mice. Once the tumors reached a measurable size, the mice were randomly divided into two groups (n = 6 each). The size of the subcutaneous tumors was recorded every three days. The experimental protocol was approved by the Sichuan University Animal Care and Use Committee, and conformed to the Guide for the Care and Use of Laboratory Animals of the National Academy of Sciences. Intraperitoneal injection of sodium pentobarbital at a dose of 200 mg/kg caused excessive anesthesia and rapid loss of consciousness followed by death in mice.

Statistical analysis

The overall survival analysis, Student’s t-test, and one-way ANOVA were performed using GraphPad Prism 8 (GraphPad Software, San Diego, CA, USA). Statistical significance was set at p < 0.05.