Small molecules, viruses and cells

Supplementary Table S1 lists compounds used in the study, their suppliers, and catalogue numbers. To obtain 10 mM stock solutions, compounds were dissolved in dimethyl sulfoxide (DMSO; Sigma-Aldrich, Germany) or water. The solutions were stored at -20 °C until use. Supplementary Table S2 lists viruses used in the study, and their sources. EV1, EV6, EV11, CVB5 were amplified in a monolayer of A549 cells, EVA71 was amplified in Vero cells, CVB6 and CVA13 were amplified in HeLa cells, and EV7 in RD cells. Virus stocks were stored at − 80 °C. Supplementary TableS lists cells used in the study, and their sources. A549, MIA PaCa-2 (MP-2), HE, RD, HeLa and Vero cells were grown in Dulbecco’s Modified Eagle’s medium (DMEM; Gibco, Paisley, Scotland) supplemented with 100 U/mL penicillin and 100 µg/ml streptomycin mixture (pen/strep; Lonza, Cologne, Germany), 4.5 g/L (= 25 mmol/L) glucose, 1 mM L-glutamine, and 10% heat-inactivated fetal bovine serum (FBS; Lonza, Cologne, Germany). RPE cells were grown in DMEM-F12 supplemented with 10% FBS, pen/strep. All cells were cultured at 37ºC with 5% CO2, 95% humidity and passaged using 0.05% (v/v) Trypsin/EDTA (Gibco). Cells were tested mycoplasma negative throughout the work (MycoAlert Mycoplasma Detection Kit, Lonza). EndoC-BH5 cells (Human cell design) were maintained in Ultib1 EndoC-BH serum free medium (Human cell design) at 37 °C with 5% CO2, and 95% humidity.

Virus infection and median tissue culture infectious dose calculation (TCID50)

The infection of A549, MP-2, HE and RPE cells was done in growth media containing 0.2% bovine serum albumin (BSA; Sigma) at a multiplicity of infection (moi) 0.1. The infection of RD, HeLa and Vero cells was done in growth media containing 1% FBS at an moi 0.1. The infection of EndoC-BH5 cells was done in DMEM containing 4.5 g/L glucose, 1 mM L-glutamine, 0.2% BSA and pen/strep at an moi 0.1. Viral sample (1 µL) at seven 10x dilutions was added to 99 µL of virus growth medium. The mixture was added to 96-well plates containing approximately 4 × 104 A549 cells/well. At 48 h post infection, cell viability was measured with Cell Titer Glo (CTG; Promega) assay and a median tissue culture infectious dose 50 (TCID50) was calculated as described previously [18].

RT-qPCRs

RNA was isolated using the RNAse kit (Qiagen) or NAxtra kit [19]. The isolated RNA was then reverse transcribed into cDNA using the SuperScript™ II Reverse Transcriptase synthesis kit (Thermo Fisher). Quantitative PCR (qPCR) was performed on the CFX Connect Real-Time PCR Detection System (Bio-Rad) using SYBR Green and virus-specific primers EV_fw: TAGTCCTCCGGCCCCTGAATGC and EV_rv: CCAATCCATAGCTATATGG. Viral RNA copy numbers were calculated using a standard curve analysis.

Alternatively, total RNA was isolated using Macherey–Nagel NucleoSpin® RNA II kit (Bioke, Leiden, The Netherlands). cDNA was synthesized by using a cDNA synthesis kit (TaKaRa Bio, Inc., Shiga, Japan). Real-time PCR reactions were performed with PowerTrack™ SYBR Green Master Mix for qPCR (Applied Biosystems, Austin, USA) on a QuantStudio™ 3 Real-Time PCR System (Thermo Fisher Scientific LifeSciences). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene was used as housekeeping gene. Relative gene expression was analyzed using 2−∆∆CT method [20]. Target gene expression was normalized to GAPDH using the formula:

$$\:\varDelta\:\varDelta\:\text\text\hspace=\hspace\varDelta\:\text\text\text\text\text\text\text\text\hspace-\hspace\varDelta\:\text\text\text\text\text\text\text\text\text$$

(1)

where ∆CT = CT [target gene] − CT[GAPDH]. Template control and reverse transcriptase control were included in all RT-qPCR experiments. The primers used are GAPDH_fw: GTCTCCTCTGACTTCAACAGCG, GAPDH_rv: ACCACCCTGTTGCTGTAGCCAA, EV1_fw: TCCTCCGGCCCCGTGA, and EV1_rv: RATTGTCACCATAAGCAGCCA.

Cell viability and death assays

The cell viability and death were measured using CellTiter-Glo (CTG), Alamar blue (Invitrogen, DAL1100, 1:10 dilution in AEM), and CellToxGreen assays (CTxG; Promega #G9241, G8741).

Measurments of glucose and human insulin levels

Accu-Chek Mobile Blood Glucometer with test cassettes was used to measure glucose levels in cell culture medium (Roche). An enzyme-linked immunosorbent assay (ELISA) kit (Invitrogen) was used for the quantitative detection of human insulin levels in cell culture medium.

Live cell imaging

Virus-induced cytotoxicity of RD, HeLa and Vero cells was assessed by live-cell imaging using an Incucyte SX5, an automated phase-contrast and fluorescence microscope within a humidified incubator, using Cytotox NIR Dye (Sartorius) at 1:1,000 dilution added directly during virus infection. At 3-hour intervals, 3 images per well were taken and used to estimate NIR-positive cells per cell using the integrated software. For each experiment, the data were plotted as NIR object count per image.

Calculation of drug sensitivity scores

Drugs were added to cells in 5-fold serial dilutions. Cells were infected with viruses (moi 0.1) or mock. The cell viability was measured using CTG assay after 48 h of infection. A drug sensitivity score (DSS) was calculated as a normalized version of the standard area under dose–response curve (AUC), with the baseline noise subtracted, and the normalized maximal response at the highest concentration (often corresponding to off-target toxicity):

$$\:DSS=\frac_-_)}_-_)}_Amin}$$

(2)

,

where activity threshold t equals 10%, and DSS is in the 0–50 range [13, 21,22,23]. The difference (DDSS) between DSS (virus) and DSS (mock) was also calculated.

Drug synergy calculations

Drugs were added to cells in 5-fold serial dilutions. Cells were infected with viruses (moi 0.1) or mock. The cell viability was measured using CTG after 48 h of infection. To test whether the drug combinations act synergistically, the observed responses were compared with expected combination responses. The expected responses were calculated based on the Bliss reference model using SynergyFinder version 3 to reveal whether changes in drug concentrations are associated with substantial increases in potency and efficacy [24]. Synergy scores were quantified as average excess response due to drug interactions for the most synergistic 4 × 4 × 4 dose-windows in dose–response matrices (i.e., 10% of cell survival beyond the expected additivity between single drugs represents a synergy score of 10).

Human organoid cultures

Pancreatic organoids. Pancreatic cancer organoid cultures from two patients PO34T and PO80T have been described [25]. Organoids were maintained in matrigel domes and complete feeding medium [26]. Organoids were digested by TrypLE Express and Dispase to single cells and 2000 cells were seeded in 10 µl 4 mg/ml matrigel per well in 384-well plates (PhenoPlate 384, Revvity #6057302). After 20 min at 37 °C, 15 µl feeding medium was added on top of the matrigel and cells were cultured for 3–4 days to obtain pancreatic organoids.

Airway organoids. To produce human airway organoids (hAOs), adult lung tissues were obtained from tumor-free material of lung of cancer patient. hAOs were cultured in airway organoid expansion medium (AEM), based on advanced DMEM/F12 (Invitrogen), supplemented with 1% penicillin/streptomycin (Life Technologies), 1 M HEPES (Life Technologies), 200 mM Ultra glutamine (Life Technologies), 2% (vol/vol) of B27 (Gibco), 1.25 mM N-acetylcysteine (Sigma-Aldrich), 10 mM Nicotinamide (Sigma-Aldrich), 10% (vol/vol) of R-spondin-1 (conditioned medium), 10% (vol/vol) of Noggin (conditioned medium), 100 ng/ml FGF10 (Peprotech), 25 ng/ml FGF7 (Peprotech), 1 µM SB202190 (Tocris), 500 nM A83-01 (Tocris) and 10 µM Y27632 (Sigma-Aldrich).

Brain organoids. The brain organoids were generated from human induced pluripotent stem cells (iPSCs) according to published protocol with few modifications [27]. The dense, intact, and single spheroids of ≥ 250 µM were transferred to ultra-low attachment 96 well plate (CLS7007) on Day 7. On Day 9 of neural differentiation spheroids were transferred to 24 well plate (Corning, 3472). For the first week of transfer, half of OLIG3 media was changed every 3rd day. Later, two thirds of the media was changed every third day until day 30. By Day 30, the organoids were expressing neural progenitor markers.

Retinal and heart organoids. To generate retinal and heart organoids, human dermal fibroblasts were first reprogrammed into iPSCs using CytoTune™-iPS 2.0 Sendai Reprogramming Kit (ThermoFisher Scientific, A16517) following the manufacturer’s instructions. The iPSCs were maintained in Essential 8™ medium (ThermoFisher Scientific, A1517001) and routinely passaged every 4 to 5 days with 0.5 mM EDTA (ThermoFisher Scientific, 15575020). Retinal and heart organoids were generated from the iPSCs using modified versions of the published protocols [28, 29], respectively. The modifications include alterations to medium composition, differentiation mediators and timing of their addition, and initial seeding density during aggregation. Additionally, orbital shaking was employed throughout the differentiation and maintenance to increase nutrient uptake. On day 20 and day 53, post-differentiation induction, the retinal and cardiac organoids, respectively, were collected for the viral infection assay.

Drug efficacy test in organoids

Pancreatic organoids. Compounds (0.1 µM pleconaril, 5 µM AG7404, and 5 µM mindeudesivir) and their combinations were introduced by acoustic dispenser (LabCyte Echo 525) and 1000 PFU of virus was added in 10 µL of feeding medium per well for a final volume of 35 µL per well. Estimated multiplicity of infection based on organoid doubling rate: 1 to 5. After 72 h, 10 µL of supernatant per well was carefully withdrawn for virus titration. CTG reagent (25 µL) was added per well. After 10 min at RT luminescence was read on the Agilent Cytation 5 plate reader/imager.

Airway organoids. Organoids were harvested from matrigel, treated with 0.1 µM pleconaril, 5 µM AG7404, 5 µM mindeudesivir and their combinations and infected with EV1 virus particles (moi = 2000 TCID50/organoid) for 1 h. Organoids were then washed by DMEM/F12 to thoroughly remove unabsorbed viruses. Organoids were embedded in matrigel and maintained in AEM with drugs at 37 °C with 5% CO2. Organoids and culture supernatant were collected for further analysis.

Retinal, heart, and brain organoids. One organoid was placed in each well in an ultralow attachment 96-well plate, with a total of 100 µl of media per well. Compounds (0.1 µM pleconaril, 1 µM AG7404, and 10 µM mindeudesivir) and their combinations were introduced and virus (20000 PFU/mL) or mock was added. After 2.5 h the media was replaced with fresh media containing compounds. After 72 h, 30 µl of media of each well was taken for virus detection by RT-qPCR. The contractions of heart organoids were monitored using microscope. The retinal organoids were sonicated, and ATP content (cell viability) was measured by CTG assay.

Live organoid imaging

Pancreatic organoids were imaged with 2,5× objective on the Agilent Cytation 5 plate reader/imager. Retinal organoids were imaged using Olympus CKX53 microscope with 10x objective and an Olympus DP28 camera. Brain organoids were imaged using Evos cell imaging system with 4× objective and fluorescent filters (ThermoFisher Scientific). Heart organoids were imaged and filmed using Olympus CKX53 microscope with 10x brightfield objective and an Olympus UC90 camera. The resulting movies were then processed using CONTRACTIONWAVE software, which enabled the quantification of contractile dynamics across different organoid regions [30]. This method allows for the extraction of detailed contraction patterns and amplitude information, providing critical insights into the functional characteristics of the heart organoids under various experimental conditions.