Plasmid and reporter cloning

Constructs were cloned into the doxycycline-inducible Lenti-X Tet-ON 3G expression system (Takara Bio, 631187) using the PTRE3GS promoter. TurboID was generously provided by A. Y. Ting at Stanford University. PSD95 was amplified from rat PSD95, and the 5′ UTR and 3′ UTR regions of PSD95 were amplified from the pCMV-5U-Venus-PSD-95-3U construct (Addgene, 102949). Superfolder GFP (sfGFP) was included between TurboID and PSD95 to visualize TurboID in live cells, and Flag tag was included at the 5′ end of TurboID to use in immunostaining. In the final 5′ UTR-TurboID-sfGFP-PSD95-3′ UTR construct, TurboID-sfGFP-PSD95 were separated by GS and NSRV linkers, respectively. All viral constructs were cloned and propagated at 30 °C. Control experiments to test the leakiness and doxycycline sensitivity of the Tet-ON 3G system were done using the luciferase reporter that was included in the Takara kit. Luciferase activity was measured using the Varioskan LUX plate reader and the SkanIt RE 5.0 program. All constructs were expressed at 300 ng ml−1 doxycycline concentration.

Myristoylation (Met-Gly-Thr-Val-Leu-Ser-Leu-Ser-Pro-Ser-Tyr) and LDLRct sequences were cloned at the 5′ and 3′ end of sfGFP, respectively, using the Gibson strategy (New England Biolabs (NEB), E5510S). Myristoylation, LDLRct, BC1 and Camk2a-3UTR were amplified from neuronal cDNA. 5′ UTRs were either amplified from neuronal cDNA or generated via gene blocks at Integrated DNA Technologies (IDT). All constructs were cloned and propagated at 30 °C. 5′ UTR and uORF mutations and eIF4G2 phosphorylation mutations were performed using a Q5 Site-Directed Mutagenesis Kit (NEB, E0554S). All clones were confirmed with forward and reverse sequencing primers using GENEWIZ Sanger sequencing services.

Lentivirus preparation and lentiviral transduction

Human embryonic kidney (HEK) 293T cells (American Type Culture Collection, CRL-11268) were cultured in DMEM (Thermo Fisher Scientific, 11965092) supplied with 10% FBS (Thermo Fisher Scientific, SH3007103), 2 mM L-glutamine (Thermo Fisher Scientific, 25030081), 1 mM sodium pyruvate (Thermo Fisher Scientific, 11360070) and 1× non-essential amino acids (Thermo Fisher Scientific, 11140076) at 37 °C under 5% CO2. The cells were passaged at 80–90% confluence by trypsinization fewer than 20 times to make the lentivirus and were seeded at 85,000 cells per cm2 confluence in 10-cm dishes 1 d before transfection. High-titer lentivirus mixes were prepared using Lenti-X Packaging Single Shots (Takara Bio, 631275) according to the manufacturer’s guidelines. HEK293T cells were incubated with the transfection media for 4–12 h, after which 6 ml of fresh media was added onto the plates. After 48 h, the supernatant was collected carefully from the dishes, centrifuged at 500g for 10 min and subsequently filtered through a 0.45-µm syringe filter. Viral soups were either flash frozen with liquid nitrogen and stored at −80 °C or used immediately. Lentivirus aliquots, which were used for the sequencing experiments, were not freeze–thawed more than once. Optimal expression of each fusion construct and the titer were determined experimentally for Pan-TurboID and TurboID-PSD95.

Primary cortical cultures

Pregnant mice were purchased from Charles River Laboratories (albino, CD-1, strain 022) and treated according to Institutional Animal Care and Use Committee guidelines at The Rockefeller University. Embryonic day (E) 14.5 embryos were sacrificed in 1× HBSS. Dissected embryonic cortical tissues were gently dissociated and digested for 30 min at 37 °C and 5% CO2 with a combination of Papain and DNaseI according to the manufacturer’s instructions (Worthington Biochemical, LK003150). Digested tissues were filtered through a 100-μm mesh and centrifuged at 1,000 r.p.m. for 4 min at room temperature. The cells were then seeded and grown in Neurobasal Medium (Thermo Fisher Scientific, 21103049) supplemented with 2% (v/v) B-27 (Thermo Fisher Scientific, 17504044) and 1% (v/v) GlutaMAX (Thermo Fisher Scientific, 35050061) at approximately 25,000 cells per cm2 on pre-coated dishes. Dishes were pre-incubated with 0.01% poly-l-ornithine at 37 °C and 5% CO2 (or room temperature) overnight, washed three times with sterile distilled water and dried before plating the cells. Additional neurons that were not going to be treated with virus were plated in separate dishes to provide conditioned media for the experimental cells. Virus was added the next day, and the media was replaced with half fresh media and half conditioned media supplied with 300 ng ml−1 doxycycline after 24 h. Primary neuronal cells were grown in vitro for 12 d, replacing one-third of the media with half fresh and half conditioned media (with doxycycline) every 3 d.

Neuronal activation by KCl depolarization

Before KCl depolarization on the 12th day, neurons were silenced with 1 µM sodium channel blocker tetrodotoxin (TTX) (Abcam, ab120054) and 100 µM NMDA receptor antagonist DL-2-amino-5-phosphopentanoic acid (DL-AP5) (Abcam, b120004) for 2 h at 37 °C and 5% CO2. TTX was dissolved in pH 4.8 citrate buffer to 1 mM, and DL-AP5 was dissolved in water to 10 mM as stock concentrations. Subsequently, neurons were activated for 1 h by adding warm KCl depolarization buffer (170 mM KCl, 2 mM CaCl2, 1 mM MgCl2 and 10 mM HEPES in Neurobasal Medium) to a final concentration of 33% of the total culture medium in the plate. Whole medium was then replaced with fresh neurobasal medium for 30 min, including biotin, TTX and DL-AP5 (biotin was included for all of the labeling experiments).

Neuronal activation by DHPG

Before depolarization on the 12th day, neurons were silenced as described in the ‘Neuronal activation by KCl depolarization’ subsection. After silencing, neurons were washed with regular media twice and incubated in regular media for 15 min before they were activated with 100 µM DHPG ((R.S.)-3,5-dihydroxyphenylglycine) (Tocris, 0805) for 10 min. DHPG medium was then replaced with fresh Neurobasal Medium for 20 min, during which biotinylation was performed.

Biotin labeling with TurboID in primary mouse cortical neurons

Cells were incubated with 100 μg ml−1 cycloheximide (Chx) for 2 min before adding 100 μM biotin for 30 min at 37 °C and 5% CO2. Inducible and controlled expression of TurboID was critical for site-specific biotinylation in neurons, consistent with the observation that constitutive expression of TurboID leads to promiscuous biotin ligase activity21. For the minus biotin samples, cells were incubated with Chx only for the same amount of time as the plus biotin samples, and all were harvested at the same time. For activated neurons, biotinylation was induced after replacing the KCl media with fresh media, which included TTX and DL-AP5 that were used to silence neurons before depolarization.

Reporter transfection

After 10 d in culture, primary cortical neurons were transfected using Lipofectamine LTX with PLUS reagent (Thermo Fisher Scientific, 15338030). For one well of a 12-well plate, TET (0.6 µg) was co-transfected along with the reporter constructs (0.6 µg) using 1.6 µl of LTX and 1.2 µl of PLUS reagents. Media was changed with fresh media including doxycycline (300 ng ml−1) after 4–6 h, and cells were harvested within 12–14 h.

Fura-2 AM and Fluo-4 AM staining and fluorescence measurement

Fura-2 AM (Abcam, ab120873) stock solution was prepared in DMSO at 10 mM. Resting cells were loaded with the Fura-2 AM dye simultaneously with the depolarized cells at a final concentration of 2 µM. The dye was added along with the KCl solution to the depolarized cells, and the cells were incubated for 45 min at 37 °C and 5% CO2. Then, cells were washed with neurobasal media three times and were kept in neurobasal media without Fura-2 AM at 37 °C and 5% CO2 for another 30 min. The fluorescence was then imaged using a Keyence microscope at the excitation wavelength 340/380. Fluorescent nuclei were counted using ImageJ software.

Fluo-4 AM (Thermo Fisher Scientific, F14201) was resuspended in DMSO to 1 mM. Similar to the Fura-2 AM strategy, resting and depolarizing cells were loaded with the Fluo-4 AM at 2 µM simultaneously at the beginning of depolarization for 45 min at 37 °C and 5% CO2. Pluronic F-127 (Thermo Fisher Scientific, P6866) was added at 0.02% to help disperse the dye in the media. Cells were then washed with regular neurobasal media three times and were kept in neurobasal media for another 30 min at 37 °C and 5% CO2. The fluorescence was then imaged using the Keyence microscope at the excitation wavelength 494/506. Fluorescent nuclei were counted using ImageJ.

In addition to imaging, fluorescence by Fura-2 AM or Fluo-4 AM was measured using the Varioskan LUX plate reader and the SkanIt RE 5.0 program at excitation/emission at 340/380 nm and 494/506 nm, respectively. Each biological replicate was calculated as the average of three wells (technical replicates) in the 96-well plate plated from the same batch of neurons.

PL-CLIP lysate preparation

For the UV-crosslinking experiments, neurons were washed twice with 1× PBS supplemented with 100 μg ml−1 Chx and crosslinked on 150-mm plates on ice in 1× PBS with Chx with one pulse of 400 mJ cm−2 and one pulse of 200 mJ cm−2. As described previously by Kaewsapsak et al.95 and Hendrickson et al.96, cells were lysed in 0.5 ml of ice-cold RIPA buffer (50 mM Tris (pH 8), 150 mM KCl, 0.1% SDS, 1% Triton X-100, 5 mM EDTA, 0.5% sodium deoxycholate, freshly supplemented with 0.5 mM dithiothreitol (DTT), 1× EDTA-free protease inhibitor cocktail (Thermo Fisher Scientific, 87785) and 100 U ml−1 RNaseOUT (Life Technologies, 10-777–019)) for 10 min on ice and clarified by centrifugation at 15,000g for 10 min at 4 °C. Samples were diluted by adding 0.5 ml of Native Lysis Buffer (NLB) (150 mM KCl, 25 mM Tris pH 7.5, 5 mM EDTA, 0.5% NP-40, 0.5 mM DTT, 1× protease inhibitor and 100 U ml−1 RNaseOUT). Lysates were subsequently flash frozen or used for streptavidin pulldowns.

PL-Ribo-seq lysate preparation and monosome fractionation

For the ORF-RATER experiments, three 150-mm cell culture dishes were combined per sample per replicate. Neurons were treated with nothing (WT), Chx (100 μg ml−1) for 2 min or harringtonine (Harr) (2 μg ml−1) for 2 min, followed by a Chx pulse. For PL-Ribo-seq experiments, four 150-mm cell culture dishes were combined per sample per replicate, one-fourth of which was spared for proteomics. The PL-Ribo-seq samples were treated with Chx (100 μg ml−1) for 2 min, followed by a 30-min biotin pulse. Both for the ORF-RATER and PL-Ribo-seq experiments, cells were quickly rinsed in ice-cold polysome gradient buffer (20 mM Tris pH 7.5, 150 mM NaCl, 5 mM MgCl2, freshly supplemented with 1 mM DTT and 100 μg ml−1 Chx) and then scraped and lysed on plates on ice in 1 ml of ice-cold polysome lysis buffer (20 mM Tris pH 7.5, 150 mM NaCl, 5 mM MgCl2, 1% Triton X-100 (Thermo Fisher Scientific, 85111), freshly supplemented with 20 U ml−1 SUPERase-In RNase inhibitor (Thermo Fisher Scientific, AM2694), 24 U ml−1 Turbo DNase (Thermo Fisher Scientific, AM2239), 1 mM DTT, 100 μg ml−1 Chx and 1× EDTA-free protease inhibitor (MilliporeSigma, 11836170001)). Lysates were clarified by centrifugation at 20,000g for 2 min at 4 °C, after which the supernatant was immediately loaded onto the cold 5-ml 7-kDa molecular weight cutoff (MWCO) Zeba desalting column (Thermo Fisher Scientific, 89892) that was previously equilibrated with the ice-cold polysome gradient buffer. This step was tested to be necessary to minimize post-lysis biotinylation and was omitted for the ORF-RATER samples. Lysates were subsequently flash frozen or used for monosome fractionation. For monosome fractionation, lysates were added 5 mM CaCl2, incubated with micrococcal nuclease (3 U μg−1 of RNA) for 45 min at room temperature, quenched with 6.25 mM EGTA and loaded on sucrose gradients as previously described97. Samples were then centrifuged for 2 h at 41,000 r.p.m. in an SW-41 rotor (Beckman Coulter), and monosomes were collected using BioComp Gilson fraction collection (Gilson FC203B collector) and Triax software (BioComp Instruments).

PL-MS lysate preparation

One-fourth of the lysate from the ribosome profiling experiments before spin was spared for the MS experiments. To this fraction of lysate, SDS and sodium deoxycholate were added at final concentrations of 0.1% and 0.5%, respectively, to increase lysis efficiency and release of membrane proteins. The additional detergent-included lysate was then incubated on ice for 10 min and clarified by centrifugation at 15,000g for 5 min at 4 °C. The lysate was then desalted with the Zeba desalting column and either flash frozen or subsequently used for streptavidin pulldowns. Minus biotin samples were prepared the same way but without a biotin incubation step before harvesting the cells.

Streptavidin pulldowns

For TurboID-CLIP RNA sequencing experiments, 15% of the lysate was taken for input, and 50 µl of RIPA:NLB equilibrated C1 magnetic beads (Thermo Fisher Scientific, 65-001) was added to the remaining lysate. The pulldown was allowed to proceed overnight at 4 °C. Beads were then washed briefly at 4 °C with ice-cold (1) RIPA buffer twice; (2) high-salt buffer (1 M KCl, 50 mM Tris, pH 8, 5 mM EDTA); (3) urea buffer (2 M urea, 50 mM Tris, pH 8, 5 mM EDTA); (4) RIPA buffer; (5) 1:1 RIPA:NLB; (6) NLB; and (7) TE (10 mM Tris, pH 7.5, 1 mM EDTA). All buffers were supplemented with 100 U ml−1 RNaseOU. The inputs and beads were then treated with sarkosyl and proteinase K (2% N-lauryl sarkosyl, 10 mM EDTA, 5 mM DTT, in 1× PBS, supplemented with 200 µg of proteinase K (Roche) and 4 U of RNaseOUT) at 42 °C for 1 h, followed by 55 °C for 1 h to digest the biotinylated proteins and free the bound RNAs. RNA isolation was then performed using TRIzol (Thermo Fisher Scientific, 15596026) according to the manufacturer’s instructions.

For the ribosome profiling experiments, 10% of the monosome fraction was kept for input. Triton X-100 was added to the remaining monosomes to a final concentration of 0.05%. The biotinylated monosomes were isolated using 50 µl of MyOne streptavidin C1 magnetic Dynabeads that were prepared according to the manufacturer’s guidelines and washed twice with Buffer A (100 mM NaOH, 50 mM NaCl), twice with Buffer B (100 mM NaCl) and once with polysome gradient buffer (with DTT and Chx). The monosome and bead mix was mutated at 4 °C overnight. The supernatant was removed the next day, and the beads were moved into a new tube with low-salt wash buffer (20 mM Tris pH 8, 150 mM NaCl, 5 mM MgCl2, 1 mM DTT, 100 μg ml−1 Chx and 0.1% Triton X-100) and consequently washed three times for 10 min at 4 °C with high-salt wash buffer (20 mM Tris pH 8, 500 mM NaCl, 5 mM MgCl2, 1 mM DTT, 100 μg ml−1 Chx and 0.1% Triton X-100). The beads were then moved into a new tube with the low-salt binding buffer, and RNA extraction was performed on the pulldowns and inputs using TRIzol.

Pulldowns for the MS and control pulldown experiments were performed on whole cell lysates described in the ‘PL-MS lysate preparation’ subsection. The lysates were diluted five-fold with 1× PBS. Then, 50 µl of C1 magnetic Dynabeads was washed three times with 1× PBS and incubated with the lysates for 30 min at room temperature, followed by at 4 °C overnight. The next day, beads were moved into a new tube with the low-salt wash buffer and washed with the high-salt wash buffer twice for 5 min at 4 °C. After the high-salt washes, beads were washed once with 0.5% Tween 20 (in 10 mM Tris pH 8) for 5 min at 4 °C, once with 2 M urea (in 10 mM Tris pH 8) for 3 min at room temperature and three times with 10 mM Tris pH 8 for 3 min each at room temperature, changing tubes each time for the last three washes. Changing the tubes notably reduced the detergent contamination in the samples.

Library preparation

For PL-CLIP, total RNA (input and pulldown, ~100 ng) was used as the starting material and first treated with DNAse on columns. TruSeq stranded RNA sample protocol was followed using RiboZero to get rid of ribosomal RNAs (Illumina, 20020594). For unique adapters, IDT Illumina TruSeq RNA UD Indexes (Illumina, 20022371) were used. The samples were then pooled and sequenced on an Illumina NovaSeq 6000 sequencer.

For ribosome profiling libraries, input and pulldown samples were prepared with barcoded linkers as described previously97,98. Pooled libraries were then sequenced on the Illumina NovaSeq 6000 sequencer.

MS

Proteins coupled to streptavidin-coated magnetic beads were reduced with 10 mM DTT and alkylated with 25 mM iodoacetamide (Sigma-Aldrich). Proteins were eluted from beads using partial on-bead trypsinization with 0.5 µg of trypsin (Promega), followed by a second digestion with a 1:1 solution of 0.5 µg of trypsin (Promega) and 0.5 µg of LysC (Wako). Samples were then solid-phase extracted using C18 micro-purification tips constructed in-house and analyzed by liquid chromatography with tandem mass spectrometry (LC–MS/MS). For LC–MS/MS, samples were separated by reversed-phase chromatography using an analytical gradient (98% A, 2% B and 62% A, 38% B where A is 0.1% formic acid and B is 80% acetonitrile in 0.1% formic acid) for 50 min in 12-cm built-in-emitter columns. Spectra were collected using an Orbitrap Fusion LUMOS (Thermo Fisher Scientific). Then, spectra were queried against a Mouse UniProt proteome FASTA database (March 2020) using Proteome Discoverer 1.4 (Thermo Fisher Scientific) and Mascot 2.4 (Matrix Science). Perseus version 1.6.10.50 was used for data analysis. Matched proteins were filtered for possible contaminants. Proteome Discoverer 1.4–calculated protein abundances (average of the three most abundant peptides for a matched protein) were log2 transformed. Matched proteins were filtered, keeping only proteins with signals in a minimum two-thirds of the replicates for at least one condition. Missing signals were imputed (width, 0.3; downshift, 1.8), followed by a quartile-based width adjustment normalization as described in the Perseus software documentation. Overall, 4,418 proteins were detected, and 2,776 unique ones that passed all the quality controls were used for the downstream analyses. Resting and depolarized enriched proteomes were determined with significance cutoff of log2 > 0 and P < 0.05 using the two-tailed, paired Student’s t-test on Pan-TurboID versus TurboID-PSD95 replicates after the minus biotin counterpart was subtracted from each sample. Differential (depolarized minus resting) enriched proteome was determined with significance cutoff of log2 > 0 and P < 0.05 using the two-tailed, unpaired Student’s t-test on resting versus depolarized replicates (Supplementary Table 2).

IF

In brief, neurons were grown in two-well or four-well chambered Nunc Lab-Tek II coverglasses that were previously coated with poly-l-ornithine as described in the ‘Primary cortical cultures’ subsection. Cells were rinsed with 1× PBS twice and fixed with 4% paraformaldehyde (PFA) at room temperature for 10 min. After fixation, cells were washed with 1× PBS three times and permeabilized in 0.2% Triton X-100 (in 1× PBS) for 10–15 min on ice. Cells were washed again three times with 1× PBS and blocked in 3% donkey or goat serum (depending on the secondary antibody) diluted in 1× PBS for 1 h at room temperature. Primary antibody diluted in 3% serum in 1× PBS was added for overnight incubation at 4 °C, followed by three 1× PBS washes the next day and secondary antibody (diluted in 3% serum in 1× PBS) incubation for 2 h at room temperature. Three 1× PBS washes were performed after the secondary antibody incubation, and DAPI was added during the second wash. The cells were kept in 1× PBS at 4 °C in dark until imaging. A Keyence Bz-9000e fluorescence microscope was used to image IF samples. IF images were quantified in ImageJ using the same threshold parameters across resting and depolarized conditions. To calculate the dendritic signal specifically, MAP2 co-localization was used as a proxy, and the signal surrounding the soma was subtracted. ROI Manager was used to select dendrites and measure fluorescence intensity, and background was subtracted for each image.

RNA FISH

RNA FISH was performed using the RNAscope assay according to the manufacturer’s instructions. In brief, for primary cortical neurons, fixation was performed with 4% PFA for 30 min at room temperature. The cells were then washed with 1× PBS twice and dehydrated with 50% EtOH, 70% EtOH and 100% EtOH with each incubation for 5 min, performed twice. The cells were left in 100% EtOH at −20 °C at least for half an hour before proceeding with the rest of the FISH protocol. Before protease treatment, the cells were rehydrated with 70% EtOH and 50% EtOH for 2 min at room temperature and washed with 1× PBS. ProteaseIII from the RNAscope kit was diluted 15-fold in RNAse-free water, and the diluted protease was applied to cells for 10 min at room temperature. The rest of the incubations for the ACD probe (pTHSSe-sfGFP-C2, ACD Bio, 844781-C2) and washes were performed according to the manufacturer’s instructions. When combining FISH with IF, one of the channels was spared for IF, and the amplification step for that channel was omitted. Instead, cells were blocked with 3% serum in 1× PBS for 1 h at room temperrature and then incubated with the primary antibody in 3% serum overnight at 4 °C. The rest of the IF protocol was followed as described in the ‘IF’ subsection. Imaging slides were kept in ProLong Gold Antifade (Thermo Fisher Scientific, P10144) with a coverslip at 4 °C for a few weeks or at −20 °C for longer periods. Samples were imaged using the Keyence Bz-9000e fluorescence microscope. FISH signals were quantified using the ImageJ ‘threshold’ and ‘analyze particles’ features. Signals within DAPI and in MAP2 were counted separately to differentiate the soma and dendrites.

PLA

PLAs were performed to detect nascent protein production in neurons. To detect new protein production, puromycin (Thermo Fisher Scientific, A1113803) was incorporated at 2 µM for 10 min at 37 °C and 5% CO2. Cells were then washed with pre-warmed PBS-MC (1× PBS pH 7.4, 1 mM MgCl2, 0.1 mM CaCl2), fixed in PBS-MC supplemented with 4% PFA and 4% sucrose, washed with PBS-MC again and permeabilized in 0.5 % Triton X-100 in 1× PBS for 15 min as described previously99. Anti-puromycin and protein-specific antibodies were used in combination for each protein of interest. Blocking, PLA probe application, ligation and amplifications were performed using the Duolink kit (Sigma-Aldrich, DUO92101) according to the manufacturer’s recommendations. Samples were imaged and quantified as described in the ‘RNA FISH’ subsection.

Western blots

Lysates were boiled at 95 °C for 5 min with NuPAGE LDS Sample Buffer (NP0007) and NuPAGE Sample Reducing Agent (NP0009) and run in 4–12% Bis-Tris gels. Protein transfers were performed using the iBlot2 nitrocellulose dry transfer system (at 20 V for 6 min for proteins <20 kDa and 25 V for 7 min for >20 kDa). The membranes were blocked in Intercept TBS Blocking Buffer for 1 h at room temperature (LI-COR Biosciences, 927-60001). TBS buffer performed better in minimizing the background signal, especially for streptavidin blots. Primary antibodies were diluted according to their specifications in the Intercept buffer and incubated with the membranes on orbital shakers overnight at 4 °C. The next day, membranes were washed in TBST (1× TBS with 0.1% Tween 20) for 5 min at room temperature three times and incubated with the secondary antibodies diluted in TBST for 2 h at room temperature. If the membranes were going to be blotted for biotin, they were incubated with the streptavidin antibody diluted in TBST for 7–10 min at room temperature after the secondary antibody incubation. The membranes were washed again in TBST for 5 min at room temperature three times. Two more PBS washes were added if the membranes were blotted for streptavidin.

The samples for reporter constructs were divided into two, one half for the western and the other for RNA extraction for each biological replicate. If sequential antibody incubation was performed, the western blots were stripped at room temperature or at 37 °C (if high-affinity antibody was used) using the Restore PLUS Stripping Buffer (Thermo Fisher Scientific, 46430) for 10–15 min and subsequently blocked in the Intercept TBS Blocking Buffer before the next antibody incubation.

Quantitative polymerase chain reaction

Total RNA was prepared using TRIzol after the lysates were treated with RQ1 DNase (Promega, M6101) according to the manufacturer’s instructions. cDNA was generated using iScript reverse transcription mix (Bio-Rad, 1708891), and quantitative polymerase chain reaction (qPCR) was performed using the FastStart SYBR Green Master (Roche, 04673492001). The forward and reverse primers used were: TACCGTTAGCCCCTATGCCATC and CTCGGTTGCCCATCCTCACC for Arc; ATGCTCCCCGGGCTGTATTC and GATCTTCTCCATGTCGTCCCAG for β-Actin; AACACACAGGACTTTTGCGC and GCTCTGGTCTGCGATGGG for Fos; ATGACTGCAAAGATGGAAACG and CAGGTTCAAGGTCATGCTCT for Jun; CAGACAACCATTACCTGTCGAC and CTCTGTGGTCTTCTGGTAGACT for the GFP reporter; GCACTAAGCCGAATGCCTTCT and CTCTGTGGTCTTCTGGTAGACT for the Mphosph9 reporter; and CTCGATGCCCATCTCTACTGGT and CTCTGTGGTCTTCTGGTAGACT for the Kcnj9 reporter.

Antibodies and fluorescent dyesFluorescent streptavidin conjugate

Streptavidin (1:5,000 for western blots and 1:10,000 for IF; Thermo Fisher Scientific, S32358).

Primary antibodies

Puromycin (1:3,000, mouse, Kerafast, EQ0001, RRID: AB_2620162), Flag (1:3,000, mouse, Sigma-Aldrich, F1804, RRID: AB_262044), β-Actin antibody (1:2,500, mouse, Sigma-Aldrich, A1978, RRID: AB_476692), RPL10A (1:1,000, rabbit, Abcam, ab174318), MAP2 (1:2,500, guinea pig, Synaptic Systems, 188004, RRID: AB_2138181), GFAP (1:500, rabbit, Abcam, ab7260, RRID: AB_305808), OLIG2 (1:500, rabbit, Proteintech, 13999-1-AP, RRID: AB_2157541), PSD95 (1:500, mouse, Millipore, MABN68, RRID: AB_10807979), Synaptophysin (1:300, mouse, Abcam, ab8049, RRID: AB_2198854), SHANK3 (1:500, mouse, Novus, NBP1-47610, RRID: AB_10010567), GKAP (1:500, rabbit, Novus, NBP1-76911, RRID: AB_11017331), NLGN1 (1:200, mouse, Novus, NBP2-42192), HOMER1 (1:1,000, rabbit, Proteintech, 12433-1-AP, RRID: AB_2295573), GAPDH (1:5,000, mouse, Thermo Fisher Scientific, AM4300, RRID: AB_2536381), BAIAP2 (1:500, rabbit, Proteintech, 11087-2-AP, RRID: AB_2063075), DLGAP3 (1:500, rabbit, Proteintech, 55056-1-AP, RRID: AB_10858793), TBR1 (1:500, rabbit, Proteintech, 20932-1-AP, RRID: AB_10695502), H4 (1:1,000, mouse, Abcam, ab31830, RRID: AB_1209246), H2A.X (1:1,000, rabbit, Proteintech, 10856-1-AP, RRID: AB_2114985), EEF2 (1:1,000, rabbit, Cell Signaling Technology, 2332, RRID:AB_10693546), P-EEF2 (1:1,000, rabbit, Cell Signaling Technology, 2331, RRID: AB_10015204), eIF2α (1:1,000, rabbit, Cell Signaling Technology, 9722, RRID: AB_2230924), P-eIF2α (1:1,000, rabbit, Cell Signaling Technology, 3398, RRID: AB_2096481), p42/44 MAPK (1:1,000, rabbit, Cell Signaling Technology, 4695, RRID: AB_390779), P-p42/44 MAPK (1:1,000, rabbit, Cell Signaling Technology, 9101, RRID: AB_331646), P-IRE1 (1:500, rabbit, Novus, NB100-2323SS, RRID: AB_10145203), IRE1 (1:500, rabbit, Novus, NB100-2324SS, RRID: AB_10000972), CHOP (1:1,000, mouse, Cell Signaling, 2895T, RRID: AB_2089254), ATF4 (1:1,000, rabbit, Cell Signaling Technology, 11815S, RRID: AB_2616025), MPHOSPH (1:300, rabbit, Biorbyt, orb100446), KCNJ9 (1:300, rabbit, LSBio, LS-C352416), KCNJ9 (1:300, mouse, Antibodies Incorporated, 75-445, RRID: AB_2686912), eIF4G2 (1:1,000, rabbit, Cell Signaling Technology, RRID: AB_10622189 and rabbit, Cell Signaling Technology, RRID: AB_2261993), NSUN3 (1:250, rabbit, LSBio, LS-C163024), MTF1 (1:300, rabbit, Novus, NBP1-86380, RRID: AB_11011361), ZFP64 (1:300, rabbit, Proteintech, 17187-1-AP, RRID: AB_2218826) and KATNBL1 (1:250, rabbit, Proteintech, 24795-1-AP, RRID: AB_2879730).

Secondary antibodies

The dilution used for the secondary antibodies was 1:1,000. Donkey anti-rabbit 800 (LI-COR Biosciences, 926-32213), donkey anti-rabbit 680 (LI-COR Biosciences, 926-68073) and goat anti-mouse 800 (LI-COR, 926-32210) for western blots. Donkey anti-mouse Alexa Fluor 488 (Thermo Fisher Scientific, R37114, RRID: AB_2556542), donkey anti-guinea pig Alexa Fluor 488 (Jackson ImmunoResearch, 706-545-148, RRID: AB_2340472), donkey anti-rabbit Alexa Fluor 647 (Jackson ImmunoResearch, 711-605-152, RRID: AB_2492288) and donkey anti-mouse Alexa Fluor 555 (Thermo Fisher Scientific, A-31570, RRID: AB_2536180).

siRNA knockdowns

Knockdown of eIF4G2 was performed using Lipofectamine LTX with PLUS reagent (Thermo Fisher Scientific, 15338030) at greater than 85% confluency at days 8–9 in vitro for 48–72 h. The siRNA for eIF4G2 (Santa Cruz Biotechnology, sc-35170) was optimal at 20 nM final. A non-targeting siRNA control was included for both resting and depolarized conditions.

For the eIF4G2 rescue experiments, knockdown of eIF4G2 was performed using 15 nM siRNA and 1.4 µl of LTX and 1 µl of PLUS reagents to keep the neurons healthier for the next round of transfections, and neurons were transfected with the dendritic eIF4G2 variants 48 h after siRNA knockdown as described in the ‘Reporter transfection’ subsection. The eIF4G2 variants were conjugated to myristoylation and LDLR-C-terminal sequences to localize them in dendrites (similar to our dendritic reporters), which rendered the size of eIF4G2 to be higher and allowed us to see the levels of endogenous eIF4G2 knockdown (Extended Data Fig. 10d).

Calcium deprivation by EGTA

Resting or silenced neurons were treated with 10 mM EGTA for 10 min at 37 °C and 5% CO2 to test if the KCl-mediated effects on translation were dependent on calcium influx. For the depolarized cells, KCl was added after the EGTA treatment.

Induction of stress

Neurons were treated with 0.5 mM sodium arsenite (NaAsO2) (Sigma-Aldrich, S7400) at 37 °C and 5% CO2 for 1.5 h.

CLIP

Neurons were washed twice with 1× PBS with 100 μg ml−1 Chx and UV crosslinked on ice in the same wash buffer with one pulse of 400 mJ cm−2 and one pulse of 200 mJ cm−2. Cells were then immediately scraped in fresh 1× ice-cold PBS with Chx and centrifuged at 5,300g for 5 min at 4 °C. The pellets were flash frozen or processed as described previously14,100 with modifications. Five biological replicates were used, each replicate prepared from three 15-cm cell culture dishes. Pellets were resuspended in 0.5 ml of lysis buffer (1× PBS, 0.1% SDS, 0.5% NaDOC, 0.5% NP-40 with freshly added protease inhibitor), and immunoprecipitations were performed overnight at 4 °C using the rabbit monoclonal antibody against eIF4G2. Resting and depolarized samples were pooled after barcoding at the reverse transcription step to increase yield.

BioinformaticsPL-CLIP analysis

Transcript expression was quantified from RNA sequencing (RNA-seq) reads using salmon and mm10 UCSC knownGene gene models using the ‘TxDb.Mmusculus.UCSC.mm10.knownGene’ Bioconductor package. The longest transcript for each gene was used for all analyses. Lowly expressed genes were filtered with edgeR’s ‘filterByExpr’ command101. limma’s ‘voomWithQualityWeights’102,103 was used for differential gene expression analysis by grouping pulldown samples according to condition (rest versus dep) and bait (Pan versus PSD95). To determine transcripts that are localized in a given condition, limma was used to compare the TurboID-PSD95 pulldown to the Pan-TurboID pulldown (PSD95 − Pan). For depolarized versus resting comparisons, these contrasts were compared ((Dep-PSD95 − Dep-Pan) − (Rest-PSD95 − Rest-Pan)). The design model included group and batch (for the four replicates). Multiple test correction was performed using the ‘decideTests’ function, using the Benjamini–Hochberg method. Localized transcripts were defined by t-statistic >1 in resting and depolarized and >1.25 for depolarized versus resting comparisons (Supplementary Table 1).

PCA

PCA was calculated by taking the top 500 variable genes into account and using the ‘prcomp’ and ‘pcascree’ functions in RStudio. For visualization, the ‘fviz_pca_ind’ function from the ‘factoextra’ package was used.

GSEA and GSEA-based analysis to compare RNA-seq, Ribo-seq and proteomics datasets

To identify the gene sets enriched in the relevant dendritic datasets, GSEA was performed using the ‘fgsea’ package from Bioconductor (https://www.biorxiv.org/content/10.1101/060012v3), using false discovery rate (FDR) < 0.05 and default settings unless otherwise stated.

For the dataset comparisons, instead of using pathways (Gene Ontology terms) in the ‘fgsea’ package, actual gene names from the list that was being compared were fed to the ‘fgsea’ function. For Fig. 2a and Extended Data Figs. 2c and 4e, genes were ranked according to dendritic enrichment in resting PL-CLIP; for Extended Data Fig. 5d,h, genes were ranked by dendritic enrichment in resting PL-Ribo-seq; for Extended Data Fig. 5j, genes were ranked by dendritic enrichment in differential PL-Ribo-seq; and for Extended Data Fig. 4b,c, genes were ranked by dendritic enrichment in resting PL-MS.

PL-Ribo-seq data analysis

FASTQ files were processed using the Bioconductor ‘Rfastp’ package. Adapters were trimmed, and low-quality reads were removed using the same package. Demultiplexing was performed using ‘fastq-multx’. Six-nucleotide unique molecular identifiers were removed from the 5′ end. Finally, reads longer than 20 nucleotides were used for the following analyses. The processed FASTQ files were mapped to mm10 (UCSC) with ‘Rsubread’104. The counts of each transcript in each sample were calculated by Plastid53,58 with the annotation GTF file generated from the ‘TxDb.Mmusculus.UCSC.mm10.knownGene’ package of Bioconductor. Raw counts and reads per kilobase per million mapped reads (RPKM) per transcript were generated, and the longest transcript per gene was selected. The RPKMs of each sample were merged and normalized with quantile normalization.

riboWaltz52 was applied to assess ribosome profiling quality control. In brief, the transcript-aligned BAM files were generated by STAR. Then, the quality control plots, including trinucleotide periodicity and P-site phasing, were generated according to the instructions in riboWaltz.

CDS dendritic translation for each sample was determined by normalizing TurboID-PSD95 pulldown to the average of Pan-TurboID and TurboID-PSD95 inputs. Dendritic translation in resting and depolarized neurons was calculated by taking the log2 transforms of normalized RPKM values of CDSs in each condition. To test the significance of dendritic translation in resting and depolarized data, we used the likelihood ratio test (LRT) in edgeR. In brief, the counting matrix of transcripts in each replicate was modeled with a genewise negative binomial generalized linear model. Then, dendritic translation and P values were tested with the LRT with basemean >1. Differential CDS dendritic translation (depolarized minus resting) was calculated by taking the difference of the depolarized and resting log2 RPKM of TurboID-PSD95 pulldown and average of TurboID-PSD95 and Pan-TurboID inputs for the longest transcript per gene. To test the significance of differential expression, the log2 fold change of each transcript was z-transformed. The P value of each transcript was calculated based on the normal distribution of z-score (cutoff: ±1.96, 2.5% top/bottom). If the basemean value for a transcript was <1 in the differential but >1 in the corresponding resting and depolarized sets, then the value of the highest expressed transcript was used for the differential. For each transcript, the normalized counts for each replicate were calculated. For significance cutoff, log2 fold change >0 with P < 0.05 was used unless otherwise stated (Supplementary Table 3).

To determine the ribosome occupancy in the 5′ UTRs, RPKMs, segregated by Ensembl transcript ID, of 5′ UTRs in each sample were calculated with Plastid53,58. Then, the RPKM changes for each region between resting and depolarized conditions were tested using the permutation t-test. The P values were then adjusted with Bonferroni correction.

5′ UTR dendritic translation in resting and depolarized ribosome profiling data was calculated by taking the difference of the log2 RPKM of TurboID-PSD95 pulldown and average of TurboID-PSD95 and Pan-TurboID inputs for the longest transcript per gene with basemean cutoff of 3. Translation of all the detected uORFs was calculated by taking into account transcript levels using PL-CLIP data to establish that the observed effects are independent of RNA level changes in dendrites (t-stat for both conditions <1 out of all the detected transcripts) and mediated by translational control (Fig. 3h). To establish more stringent, dendritically enriched translated 5′ UTRs, the difference between the log2 RPKM of TurboID-PSD95 and Pan-TurboID enrichments was considered for the longest transcript per gene in the differential data (increased with depolarization, depolarized minus resting). If the basemean value for a transcript was <1 in the differential but >1 in the corresponding resting and depolarized sets, then the value of the highest expressed transcript was used for the differential. To determine the significance, the log2 fold change of each transcript was z-transformed. The P value of each transcript was calculated based on the normal distribution of z-score (cutoff: ±1.96, 2.5% top/bottom) (Supplementary Table 5).

Dendritic targets with increased 5′ UTR and CDS translation were determined by >0 of log2 and P < 0.05 cutoff, taking into account transcript levels determined by TurboID-PSD95 RNA-seq data (differential PL-CLIP t-stat <2). Dendritic targets with increased 5′ UTR but decreased CDS translation were determined as >0 of log2 and P < 0.05 cutoff, taking into account transcript levels determined by TurboID-PSD95 RNA-seq data (differential PL-CLIP t-stat >−2) (Supplementary Table 5).

RBP motif analysis

Motifs (in the form of position weight matrices) for RBPs were obtained from RBPmap (http://rbpmap.technion.ac.il/) for mouse72. A background list was made based on all expressed transcripts in primary cortical neurons determined by our PL-CLIP data using the longest transcript per gene. Motif search was performed on 5′ UTR sequences for transcripts of interest using the ‘countPWM’ function in the ‘Biostrings’ package using a minimum score of 95%. Hypergeometric testing was performed to test for enrichment of motifs among dendritically translated 5′ UTRs (when compared to all expressed 5′ UTRs) with FDR < 0.1. The ‘seqLogo’ and ‘pheatmap’ packages were used to visualize the binding motifs and generate the heatmaps, respectively.

RBP sites in 5′ UTRs were determined by defining the dendritically increased 5′ UTR translation as >0 of log2, P < 0.05 in 5′ UTR PL-Ribo-seq and dendritically increased CDS as >0 of log2, P < 0.05 and dendritically decreased CDS as <0 of log2, P < 0.05 (Fig. 5a) in CDS PL-Ribo-seq, taking into account transcript levels determined by TurboID-PSD95 RNA-seq data (differential PL-CLIP t-stat <2 for increased and t-stat >−2 for decreased CDS targets). For comparison of RBP binding sites in dendritic 5′ UTRs enriched in resting, depolarized and differential (depolarized minus resting) PL-Ribo-seq (Extended Data Fig. 7a), the top approximtely 800 significant genes in each category were considered based on the basemean cutoffs mentioned in the ‘PL-Ribo-seq data analysis’ section (5′ UTR P < 0.01). For this analysis, transcript levels were taken into consideration, adjusting the lists according to PL-CLIP for each condition (resting and depolarized: t-stat <1 and differential: t-stat <1.3).

ORF-RATER analysis

For processing of ribosome profiling data, linker sequences were removed from sequencing reads, and samples were de-multiplexed using FASTX-clipper and FASTX-barcode splitter (FASTX-Toolkit). Unique molecular identifiers and sample barcodes were then removed from reads using a custom Python script. Bowtie version 1.1.2 was used to filter out reads aligning to rRNAs and contaminants, and all surviving reads were aligned to the mouse transcriptome with TopHat version 2.1.1 using –b2-very-sensitive–transcriptome-only–no-novel-juncs–max-multihits = 64 flags. These alignments were assigned a specific P-site nucleotide using a 12-nucleotide offset from the 3′ end of reads. The ORF-RATER pipeline (https://github.com/alexfields/ORF-RATER) was run starting with the BAM files as previously described58,105. All uORFs longer than nine nucleotides including the stop codon were considered with orfrater score of >0.7. For uORF comparisons with eIF4G2 CLIP and PL-Ribo-seq datasets, orfrater score >0.6 was used.

CLIP analysis

CLIP libraries were sequenced on an Illumina MiSeq to obtain 75-nucleotide, single-end reads. CLIP reads were processed as described previously106,107 using CLIP Tool Kit software to filter for quality, demultiplex, remove 5′ and 3′ linker sequences and collapse exact duplicates. The resulting reads were mapped to the mm10 genome using the ‘align’ function from the ‘Rsubread’ package104, allowing a maximum of five mismatches and a minimum fragment length of 20. 5′ UTR sequences were extracted from the ‘TxDb.Mmusculus.UCSC.mm10.knownGene’ R package, and ‘summarizeOverlaps’ from the ‘GenomicAlignments’ package108 was used to count eIF4G2-CLIP reads over each 5′ UTR. The longest transcript was used for each gene. The number of reads mapping to each 5′ UTR was normalized for library depth, and log2 (fold change, depolarized versus resting) values were calculated using a pseudocount of 0.1. Binomial tests were performed using the normalized CLIP tag values (Supplementary Table 6). To test the dendritic translation and localization of eIF4G2-bound targets in response to depolarization, log2 fold change >0 and P < 0.2 were used for eIF4G2 CLIP. To intersect eIF4G2-bound targets with the set of RNAs with enhanced 5′ UTR or CDS translation in dendrites, fold change >1 was used for the eIF4G2 CLIP and PL-Ribo-seq (with basemean >1 and differential PL-CLIP t-stat <2) lists.

Statistics and reproducibility

Representative images in Figs. 1b,c,e, 3a,b and 4a,b and Extended Data Figs. 1a,c–e,g and 6d,e,g,i were replicated independently at least three times. Biological replicates were processed (for reporter western blots, imaging and qPCRs) by E.H. and N.N. independently and were replicated independently. The number of biological replicates for each corresponding experiment is reported in the figure legends. No data exclusion was performed.

No sample size calculation was performed, but extensive work in sequencing and MS, particularly performed in neurons, informed our choices of minimal number of sample sizes to provide the required statistical power1,13,14,100. We increased the number of biological replicates to four and five for our sequencing and MS experiments, respectively, to improve the statistical power to be able to identify the differences between resting and depolarized conditions. Four biological replicates were chosen for PL-CLIP, three for PL-Ribo-seq, five for PL-MS and five for eIF4G2 CLIP. For all the other streptavidin immunoprecipitation and reporter experiments, at least three biological replicates were chosen. For the imaging studies, at least two biological replicates were chosen with multiple fields from each biological replicate that would represent the whole slide, and the number of images and fields studied for each figure is reported in the corresponding figure legends.

Data distribution was assumed to be normal, but this was not formally tested. The details of all the statistical tests used are reported in the respective figure legends.

The primary cortical neuron cell culture plates were randomized when deciding resting versus activated conditions or Pan-TurboID versus TurboID-PSD95 virus addition. All the resting and activated neuronal samples from the same biological replicate were processed simultaneously for all the experiments.

Processing of the reporter samples and imaging of resting versus activated neurons were blinded. Further blinding was not possible during the preparation of samples for RNA-seq, ribosome profiling, MS and CLIP because different conditions needed to be identified for downstream processing.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.