Animal Experiments

Experiments were performed in male C57BL/6 J mice aged 7–8 weeks, which were obtained from Charles River (Beijing, China). The animals used for statistical analysis had normal physiological indexes during surgical experiments. Operators of all experiments were blinded to the group allocation during all the analytical procedures. We performed myocardial I/R surgery as follows. Isoflurane (2%) with pure O2 ventilation at 2 L/min was used for anesthetization, and the heart was exposed through a left thoracic incision. Myocardial ischemia was induced by making a slipknot around the left anterior descending coronary artery with a silk suture (Ethicon, Cincinnati, USA). After 45 min, the slipknot was released to allow reperfusion for 24 h. Bufalin was administered to the mice by intraperitoneal injection (0.5 mg/kg) at the beginning of reperfusion. After 24 h of reperfusion, echocardiography was performed and then the hearts of the I/R-exposed mice were harvested for macrophage isolation, staining, and protein extraction. Peripheral blood was collected for ELISA.

Echocardiographic Assessment

After sham or I/R injury, transthoracic echocardiography was used to assess the cardiac structure and function of the mice. The mice were anesthetized with 2% isoflurane. Their body temperatures were maintained between 36.9 °C and 37.3 °C. The echocardiographic parameters were measured by a VisualSonics Imaging System (Fujiflim, Tokyo, Japan). M-mode echocardiography was used to measure left ventricular ejection fraction (LVEF) and factional shortening (FS). All echocardiographic parameters of the baseline and each group were shown in Supplementary Data (Table S1 and Table S2). The measurements were collected from more than three beats by using a Vevo 2100. The measurements were conducted by an investigator who was blinded to the treatment group.

5-Triphenyl Tetrazolium Chloride (TTC)/Evans Blue (EB) Staining

Twenty-four hours after reperfusion, the mice were anesthetized with isoflurane, and anesthesia was maintained at a low level with a mask. We opened the chest cavity of the mice, occluded the left anterior descending coronary artery at the ligation site, and injected 0.2 ml of 1% Evans Bule (E2129, Sigma) into the left auricle until the tongue and limbs of the mice turned blue. Then, the heart was excised, washed with phosphate-buffered saline, frozen at −20℃ for 30 min, and cut horizontally into 5 slices. The slices were incubated with 1% TCC (T8877, Sigma) for 15 min at 37 °C. Then, 4% paraformaldehyde solution was added to stop the staining. The slices were captured by a Perfection V19 scanner (Epson, Suwa, Japan), and the area of the infarct region (pale) and area at risk (pale and red) were measured by ImageJ 1.54f. The infarct size was calculated as the area of the infarct region divided by the area at risk.

Immunoblotting Analysis

Immunoblotting analysis was performed to determine the expression levels of target proteins. Proteins were extracted from cell or tissue lysates by RIPA (Beyotime Biotechnology, Shanghai, China) containing 1 mM PMSF (Beyotime Biotechnology, Shanghai, China). The protein concentration was determined by BCA kit (Beyotime Biotechnology, Shanghai, China). After mixing with loading buffer (P0015, Beyotime, Shanghai, China), the proteins were separated by SDS‒PAGE (8–12.5%) and then transferred to PVDF membranes (ISEQ00010, Millipore, Burlington, USA). After blocking with 5% nonfat milk in TBST for 1 h, the membranes were incubated with primary antibodies against NLRP3 (ab263899, Abcam, Cambridge, USA), GSDMD (ab209845, Abcam), IL-1β (ab205924, Abcam), Caspase3 (9962, Cell Signaling Technology, Danvers, USA), Cleaved-caspase3 (9661, Cell Signaling Technology), Bcl-2 (3498, Cell Signaling Technology), Bax (14,796, Cell Signaling Technology), LC3A/B (12,741, Cell Signaling Technology), P62 (23,214, Cell Signaling Technology) and β-Actin (MA5-15,739-HRP, Invitrogen, Carlsbad, USA) at 4 °C overnight. Then, the membranes were incubated with secondary antibodies (AP106, Invitrogen) at room temperature for 2 h. The bands were incubated with horseradish peroxidase (HRP) substrate (wbluf0500, Millipore) and then detected by a ChemiDoc imaging system (BIO-RAD, Hercules, USA). All the bands were visualized with Image Lab 6.1 software and analyzed by ImageJ 1.54f software. β‐Actin was used as the internal control.

TdT-Mediated dUTP Nick-End Labeling (TUNEL) Staining

For tissue TUNEL staining, the hearts of mice were harvested and encapsulated in cryogen by freezing to form a frozen block. Then the frozen heart was cut to 4 μm in 4℃ by microtome. For cell staining, HL-1 cardiomyocytes were seeded in 12-well plates (CLS3336, Corning) for image capture. The tissue or cells were fixed in 4% paraformaldehyde for 30 min and then permeabilized with Triton X-100 (93,443, Sigma). TUNEL test solution (11,684,795,910, Roche, Basel, Switzerland) was added to the wells according to the manufacturer’s instructions. Finally, DAPI staining (P0131, Beyotime) was performed to label the nucleus according to the instructions. Fluorescence images of tissues were captured by a fluorescence microscopy (ZEISS) and cells were captured by inverted fluorescence microscopy (ZEISS) and merged with Photoshop v24.7. The numbers of TUNEL-positive cells and DAPI-positive cells were counted by ImageJ 1.54f. The TUNEL-positive ratio was calculated as the specific ratio of TUNEL-positive cells to DAPI-positive cells. All the images are representative of at least five randomly selected fields.

Isolation of Macrophages by Flow Cytometry

After sham or I/R surgery, mouse hearts were harvested and digested into single-cell suspensions by Multi Tissue Dissociation Kits (130–110–203, Miltenyi Biotec, Bergisch Gladbach, German). After filtration through a 70-µm filter, the single-cell suspension was counted and stained with CD45 Monoclonal Antibody, FITC (11–0451-82, Invitrogen), PerCP-Cy5.5 Anti-CD11b (M1/70, BD Biosciences, Franklin Lakes, USA), and BB700 Anti-F4/80 (T45-2342, BD Biosciences) antibodies. Then, F4/80+ macrophages were labeled with antibodies and dextran-coated magnetic particles for column-free cell separation using the EasySep™ Mouse F4/80 Positive Selection Kit (100–0659, StemCell Technologies, Vancouver, Canada). The cell suspension was acquired on a FACSAria II Cell Sorter (BD Biosciences), and data were analyzed by FlowJo v.9.5.2.

Immunohistochemical (IHC) Staining

The hearts that were harvested from each experimental group were fixed in 4% paraformaldehyde solution for 24 h, dehydrated in a graded series of alcohol, embedded in wax, and sectioned into 5 μm-thick longitudinal slices. The sections were routinely dewaxed, hydrated, and antigen retrieved. The activity of endoperoxidase was blocked by 3% H2O2 in methanol, and nonspecific sites were blocked with bovine serum albumin (BSA A8010, Solarbio, Beijing, China). Then, the sections were incubated overnight at 4 °C with a primary antibody against IL-1β (ab205924, Abcam). After washing with PBS three times, the sections were incubated for 30 min at 37 °C with HRP-conjugated goat anti-rabbit monoclonal IgG (ab6721, Abcam) and stained with diaminobenzidine (DAB, DA1010, Solarbio). The sections were then observed under a microscope, and the development of staining was terminated after 5–15 min by the addition of distilled water. The sections were then stained with hematoxylin solution (G1080, Solarbio). After washing, dehydration and fixation, the sections were scanned by Pannoramic MIDI (3DHISTECH Ltd, Budapest, Hungary). The positive area was measured by ImageJ 1.54f. All the images are representative of at least five randomly selected fields.

Enzyme-Linked Immunosorbent Assay (ELISA)

The IL-1β levels in culture medium or mouse peripheral blood samples were measured with a Mouse IL-1 β/IL-1F2 Quantikine ELISA Kit (MLB00C, R&D system, Minneapolis, USA) according to the manufacturer’s instructions.

Cell Culture and Treatment

The RAW264.7 macrophage cell line and HL-1 cardiomyocyte cell line were purchased from and identified by Genomeditech (Shanghai, China). Raw264.7 cells and HL-1 cells were cultured in Dulbecco's modified Eagle’s medium (DMEM, high glucose, 11,965,092, Gibco, New York, USA) supplemented with 10% fetal bovine serum (FBS, 30,067,334, Gibco) at 37 °C and 5% CO2. Both cell lines were subcultured when the cell density reached 80%. For hypoxia/reoxygenation (H/R) treatment, RAW264.7 cells were placed in DMEM (low glucose) without FBS and transferred to a 37℃ incubator with 5% CO2 and 95% N2 for 1 h. Then, the hypoxic medium was replaced with fresh culture medium, and the cells were transferred to a normoxia incubator for the indicated times. For conditioned medium treatment, the culture media of HL-1 cells were replaced for 24 h with the media of macrophages that had been exposed to normoxia or H/R. The cells were separately subjected to staining or protein and mRNA extraction. For bufalin treatment, 1 μM bufalin (B0261, Sigma, St. Louis, USA) was added to RAW264.7 cells after hypoxic treatment. HL-1 cells were cultured for 24 h with medium from normoxia-exposed or H/R-exposed RAW264.7 cells that had previously been treated with bufalin or not. To evaluate the effects of bufalin on cardiomyocytes, we also performed HL-1 cells conditioned medium treatment with H/R-treated macrophages and then directly added 1 μM bufalin into HL-1 cells. The cells were separately subjected to staining or protein and mRNA extraction. For interleukin-1β (IL-1β) treatment, recombinant mouse IL-1β (HY-P7073, MedChemExpress, New Jersey, USA) was added to HL-1 cells at different concentrations (0, 100 pg/ml, 300 pg/ml, 1000 pg/ml) and incubated for 24 h. For anakinra treatment, the recombinant human interleukin-1 receptor (IL-1R) antagonist anakinra (HY-108841, MedChemExpress) was added to cardiomyocytes every 6 h for 24 h when they were cocultured with normoxia-treated or H/R-treated macrophages. The cells were separately subjected to staining or protein extraction.

Propidium Iodide (PI) Staining

RAW264.7 macrophages were seeded in 12-well plates (CLS3336, Corning, New York, USA) for image capture. PI test solution (R37610, Invitrogen) was added to the culture medium to assess cell membrane integrity according to the manufacturer’s instructions. Brightfield and fluorescent images of the macrophages were captured by inverted fluorescence microscopy (ZEISS, Oberkochen, German) and merged in Photoshop v24.7. The numbers of PI-positive cells were counted, and the percentage of total cells was calculated using ImageJ 1.54f. All the images are representative of at least five randomly selected fields.

Cell Viability Assay

RAW264.7 macrophage cellular ATP levels were measured with a luminescent cell viability assay kit (G9683, Promega, Madison, USA) to assess cell viability according to the manufacturer’s instructions. Chemiluminescence detection was carried out by a SpectraMax M5 microplate reader (Molecular Devices, San Jose, USA). All data from the treatment group were normalized to those from the control group.

Quantitative Real-Time Polymerase Chain Reaction (qRT‒PCR)

Total RNA was extracted from RAW264.7 macrophages by a Column Total RNA Isolation Kit (B610583, Sangon Biotech, Shanghai, China) according to the manufacturer’s instructions. After the reverse transcription of total RNA, the p62 mRNA levels were quantified by qRT‒PCR using SYBR qPCR Master Mix (Q311-02, Vazyme, Nanjing, China) and specific primers. The sequences of the p62 primers were forward: 5′- GCACAGGCACAGAAGACAAG −3′; reverse: 5′- CCACCGACTCCAAGGCTATC −3′. The sequences of the control primers that targeted Mus-18 s were forward: 5′- CGCGGTTCTATTTTGTTGGT −3′; reverse: 5′- AGTCGGCATCGTTTATGGTC −3′. The relative gene expression levels were normalized based on the Mus-18 s levels and then compared with those in the control groups.

Measurement of Reactive Oxygen Species (ROS) Levels by DCFH-DA Staining

A DCFH-DA probe (S0033, Beyotime) was used to quantify intracellular ROS levels. RAW264.7 macrophages were plated in 12-well plates (CLS3336, Coring) for image capture. The cells were washed with PBS three times and then loaded with DCFH-DA (10 μM) and incubated for 30 min at 37 °C. Then, the cells were washed with PBS to remove excess DCFH-DA. Then, 4% paraformaldehyde was used to fix the cells. Fluorescence images were captured by inverted fluorescence microscopy (ZEISS). The ROS-positive area was measured by ImageJ 1.54f. All the images are representative of at least five randomly selected fields.

Plasmid Transfection

The p62-overexpression plasmids were designed and constructed on basis of the pEGFP-N1 expression vector by Tsingke Biotechnology (Beijing, China). The clones were amplified and confirmed by PCR, restriction digestion and sequence analysis. RAW264.7 macrophages were plated in 24-well plates (CLS3337, Coring). The DNA was extracted from the plasmid and diluted with PBS to 100 ng/μL. Then, 50μL DNA was mixed with 50μL diluted Lipofectamine® 3000 Transfection Reagent (L3000075, Thermo Fisher Scientific, Waltham, USA). 25μL mixed reagent was added to each well for 24 h. The expression efficiency was determined by immunoblotting and qRT‒PCR.

Statistical Analysis

All the statistical analyses were performed with the statistical software GraphPad Prism 9.2.0. For the in vitro and in vivo experiments, we assessed data with a normal distribution based on the central limit theorem. For experiments with one or three interfering factors, one-way ANOVA with Dunnett’s multiple comparisons test and Tukey’s multiple comparisons test were used. For experiments with two interfering factors, two-way ANOVA with Tukey’s multiple comparisons was performed. When the sample sizes between groups were different, P values were determined by Šídák’s multiple comparisons test. All data are expressed as the mean ± standard error of the mean (SEM). Each experiment was repeated at least 3 times. A 2‐tailed P value < 0.05 was considered to indicate statistical significance. The tests used to assess significance are detailed in each figure legend, and the P values of each significant difference are indicated on the graph.