Animals

C57BL/6 mice, ST2 KO (ST2–/–) mice, CX3CR1-GFP mice, and CCR2-RFP mice (male, 3-months old) were obtained from Jackson Laboratories. All mice were housed on a 12-hour light/dark cycle with ad libitum access to food and water. Animal care and procedures were reviewed and approved by the University of Pittsburgh Institute Animal Care and Use Committee and were conducted in accordance with the ethical regulations.

Transient middle cerebral artery occlusion

Transient cerebral ischemia was induced in male mice (25–30 g) via intraluminal occlusion of the left middle cerebal artery (MCA) for 60 min, as previously described [16]. Briefly, mice were anesthetized with 1.5% isoflurane in 30% O2/70% N2O. The tMCAO model was performed by insertion of a silicon-coated nylon monofilament (Doccol Corporation, Sharon, MA, USA) into the external carotid artery. The microfilament was then advanced into the internal carotid artery to block the origin of the MCA. After 60–40 min of occlusion, the monofilament was withdrawn to restore blood flow. The occlusion was confirmed by measuring regional cerebral blood flow (rCBF) with a 2-D laser speckle imaging system (PeriCam PSI System; Perimed, Järfälla-Stockholm, Sweden). Only mice with a rCBF reduction of > 70% of pre-MCAO baseline levels were included for further experimentation. A total of 98 mice (51 WT C57BL/6, 32 ST2 KO, 3 CCR2-RFP, and 12 bone marrow chimera mice) underwent tMCAO surgery in this study. Five mice were excluded due to post-surgery death or insufficient reduction of rCBF. The sham-operated mice were subjected to the same surgical procedures, but without the MCA occlusion. During surgery, mouse body temperature (37 °C ± 0.5 °C) was maintained by a thermostatically controlled heating blanket. The tMCAO surgery was performed by investigators blinded to animal genotype and experimental groupings.

Measurement of infarct volume

Infarct volumes were assessed 3d after tMCAO. Six evenly spaced coronal brain slices (25 μm thick) encompassing the MCA territory (~ 1.10 mm anterior to bregma to ~ 2.06 mm posterior to bregma) were stained with antibodies against the neuron-specific marker microtubule associated protein 2 (MAP2, Sigma-Aldrich, St. Louis, MO) for infarct volume assessment. Tissue volumes were determined using Image J software by an observer blinded to group assignments. The area of tissue loss was calculated as the area of the contralateral hemisphere minus the non-infarcted area of the ipsilateral hemisphere. Brain infarct volume was determined by multiplying the area of tissue loss by the distances between the analyzed brain sections.

Bone marrow isolation and differentiation of bone marrow-derived macrophages

Bone marrow (BM) was isolated from the femur and tibia of WT or ST2 KO mice at 8–10 weeks of age. Each bone was flushed with Dulbecco’s modified Eagle’s medium containing 2 mM EDTA to collect BM tissues. The BM tissues were passed through a 70 μm filter to remove debris, followed by centrifugation for 3 min at 300 rpm to collect BM cells. The BM cells were then cultured in plastic dishes (100 mm diameter) in macrophage culture medium (RPMI-1640, 10% FBS, 20% L929 conditioned medium, 1% penicillin-streptomycin) to promote the growth of bone marrow-derived macrophages. After 7 days in culture, the medium was supplemented with 20-ng/mL macrophage colony stimulating factor (M-CSF) and cultured for 3 more days before further experiments.

Irradiation and BM transplantation

To construct BM chimeric mice, 6-week-old C57BL/6J WT or ST2 KO recipient mice were exposed to γ irradiation at 950 rad. BM cells obtained from 8 to 10-week-old C57BL/6J or ST2 KO donors (5 × 106 cells per recipient) were transferred intravenously to recipients 2 h after irradiation. After 6 weeks of reconstitution, the chimeric mice were subjected to tMCAO, as described above. The efficiency of chimerism in recipient mice was more than 90%, according to flow cytometric analyses of blood macrophages.

Macrophage depletion and adoptive transfer

Recipient WT mice were intravenously injected with clodronate liposomes (Liposoma, CP-010-010, 200 µl/mouse/day) for 2 days to deplete circulating monocytes/macrophages. Mice were subjected to tMCAO 24 h after the final dose. Bone marrow-derived macrophages (2 × 106 cells per recipient) from WT or ST2 KO mice were transferred intravenously immediately after reperfusion.

Microglia/macrophage depletion

For microglia/macrophage depletion, PLX5622 was supplied to mice (9–10 weeks old, 25–30 g body weight) in the diet (Research Diets) at 1200 ppm (1200 mg/kg of chow), starting 7 days prior to surgery and continuing until sacrifice.

Immunofluorescence staining

Immunohistochemistry was performed on 25-µm free-floating brain sections as we described previously [16]. Primary antibodies included the following: rabbit anti-ZO-1 (abcam, Waltham, MA, USA), goat anti-CD31 (R&D Systems, Western Springs, IL, USA), rat anti-ST2 (Mdbioproducts, St. Paul, MN, USA), goat anti-IL-33 (R&D system, Western Springs, IL, USA), and rabbit anti-Iba1 (Wako, Richmond, VA, USA). Images were captured with confocal microscopy (Olympus, Shinjuku-ku, Tokyo, Japan), loaded into Image J (NIH), and quantified by two investigators blinded to grouping. Three randomly selected microscopic fields in the peri-infarct area of each brain section were analyzed, and this analyses was repeated for three consecutive coronal sections of each mouse brain. Numbers from the nine images per mouse were then averaged.

Flow cytometry

Single-cell suspensions were prepared from blood and brain as we previously reported [16]. Isolated blood cells were resuspended at 1 × 106/mL and stained with fluorophore-labeled antibodies according to the manufacturer’s instructions: CD3-APC (Thermo Fisher Scientific, Waltham, MA, USA), Ly6G-BUV395 (BD Biosciences, San Jose, CA, USA), CD11b-APC-eF780 (Invitrogen, Carlsbad, CA, USA), F4/80-BV605 (BD Biosciences, San Jose, CA, USA), ST2-FITC (Mdbioproducts, St. Paul, USA). Brain cell suspensions were prepared with Neural Tissue Dissociation Kit (T) (Miltenyi Biotec; Auburn, CA) using the gentle MACS Octo Dissociator with heaters (Miltenyi Biotec, Auburn, CA). Single cell suspensions were separated from myelin and debris by Percoll gradient centrifugation (500 g, 30 min, 18 °C). The leukocytes in the interface were collected and washed with Hank’s balanced salt solution (Sigma-Aldrich, St. Louis, MO) containing 1% fetal bovine serum (Sigma-Aldrich, St. Louis, MO) and 2 mM EDTA (Sigma-Aldrich, St. Louis, MO) before staining. Cells were stained with the following antibodies: CD31-V450 (Thermo Fisher Scientific, Waltham, MA, USA), Ly6G-BUV395 (BD Biosciences, San Jose, CA, USA), CD11b-BUV737 (BD Biosciences, San Jose, CA, USA), CD45-FITC (BioLegend, San Diego, CA, USA), F4/80-BV605 (BD Biosciences, San Jose, CA, USA), ST2-PE-Cy7 (Invitrogen, Carlsbad, CA, USA). Flow cytometric analysis was performed using an LSRII flow cytometer (BD Biosciences, San Jose, CA, USA) and data were analyzed with FlowJo software.

Western blotting

Protein was isolated from the mouse brain in vivo and endothelial cultures in vitro. Western blots were performed using standard SDS-polyacrylamide gel electrophoresis. The primary antibodies used in this study include rabbit anti-ZO-1 (Cell signaling Technology, 78896, 1:500, Danvers, MA, USA) and mouse anti-β-actin (A2228, 1:20,000; Sigma-Aldrich, St. Louis, MO, USA). Polyvinylidene difluoride (PVDF) membranes were incubated in blocking buffer (LI-COR Biosciences, Lincoln, NE, USA) for 1 h at room temperature and then incubated with primary antibodies at 4 °C overnight. The membrane was incubated with secondary antibodies for 1 h at room temperature (1:10,000, LI-COR Biosciences, Lincoln, NE, USA), and scanned with the LI-COR Odyssey Infrared Imaging System 9201-550U (LI-COR Biotechnology, Lincoln, NE, USA). The results were normalized to β-actin expression.

Assessment of BBB permeability

The fluorescent tracer Alexa Fluor 555-conjugated cadaverine (0.95 kDa; Invitrogen, Carlsbad, CA, USA) was injected through the femoral vein at a dose of 200 µg per mouse, 60 min before sacrifice. Coronal brain Sect. (25 μm thick) were prepared to visualize the leakage of tracers through the impaired BBB. To measure the extravasation of endogenous IgG, sections were blocked in an avidin-biotin solution (Vector Laboratories, Newark, CA, USA), followed by 5% (wt/vol) bovine serum albumin for 1 h. Sections were incubated with biotinylated anti-mouse IgG antibody (1:500; Vector Laboratories, Newark, CA, USA) at 4 °C overnight, and then incubated with Alexa Cy3 Streptavidin for 1 h (1:1,000; Jackson ImmunoResearch Laboratories, West Grove, PA, USA). Whole-section images were acquired using an inverted fluorescence microscope (EVOS M7000, Thermo Fisher Scientific, Waltham, MA, USA). Six evenly spaced sections encompassing the MCA territory were quantified for cross-sectional area of fluorescence. These areas were summed and multiplied by the distance between Sect. (1 mm) to yield the volume of leakage in mm3. 3D plots were generated by the built-in Surface Plot function of ImageJ using the fluorescence luminance as height. Higher-resolution images were captured with an Olympus confocal microscope.

Oxygen–glucose deprivation

Primary mouse brain microvascular endothelial cells (BMECs) were purchased from Cell Biologics (C57-6023, Cell Biologics, Chicago, IL, USA). BMECs were grown in mouse endothelial cell medium (Cell Biologics, Chicago, IL, USA). For OGD, cultured BMECs were placed in an incubator chamber (Thermo Fisher Scientific, Waltham, MA, USA) containing 94% nitrogen, 5% CO2 and 1% O2 for 6 h. Control cultures were incubated for the same period at 37 °C in humidified 95% air and 5% CO2.

In vitro BBB model

The in vitro BBB model was established in cell culture inserts as described previously [24]. The 24-well transwell PET membranes (0.4 μm pore, 6.5 mm diameter; Millicell) were coated with a gelatin-based coating solution (Cellbiologics, Chicago, IL, USA). BMECs were seeded onto the insert membrane at a density of 1.5 × 105 cells per membrane. Cultures were maintained in medium at 37 °C in humidified 95% (vol/vol) air and 5% (vol/vol) CO2 for 4d to reach confluence. BMECs were subjected to 6 h OGD or control non-OGD conditions. To measure the direct effect of IL-33 on BBB integrity, transwell BMECs were treated with IL-33 (50 ng/mL) or PBS after OGD. For BMEC-macrophage cocultures, bone marrow derived macrophages were cultured in the bottom chamber of the transwell system and were incubated in the presence of soluble IL-33 (50 ng/mL) or PBS in macrophage culture media for 24 h. The BMEC transwells were then inserted above the macrophages that cultured in the lower chambers.

To assess paracellular permeability, FITC–dextran (40 kDa; Sigma-Aldrich, St. Louis, MO, USA) was added into the luminal chamber at a concentration of 2.0 mg/mL in 500 µL media. Fluorescence intensity was measured with a fluorescence reader at 1, 2, 3, 4, and 6 h after OGD using 35 µL media from the lower (abluminal) chamber. Next, 35 µL fresh media were added to the lower chamber after each reading. The concentrations of tracers in samples were calculated from a standard curve fitted using known concentrations of tracers.

Real-time PCR and PCR array

Total RNA was isolated using the RNeasy Mini Kit, according to the manufacturer’s instructions (Qiagen, Germantown, MD, USA). Five micrograms of RNA were used to synthesize the first strand of cDNA using the First-Strand Synthesis System for RT-PCR (Bio-Rad, Hercules, CA, USA). Commercial quantitative PCR array plates (Qiagen PAMM-067Z, Germantown, MD, USA) were used to detect the expression of a series of immune response-related genes in IL-33- or PBS-treated macrophages. PCR was performed on the Opticon 2 Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) using the SYBR green PCR Master Mix (Bio-Rad, Hercules, CA, USA). The cycle time values were normalized to GAPDH levels within the same sample. The expression levels of the mRNAs were then reported as fold changes versus sham control. Il10 primers: forward TTGAATTCCCTGGGTGAGAAG, reverse ATGGCCTTGTAGACACCTTG. IL13ra2 primers: forward TCTGCTCTTGGAAACCTGG, reverse CAAGTTGGACAGTTTGCATCC.

Statistical analyses

Sample sizes for animal studies were determined based on pilot studies or our published body of work. Results are presented as mean ± SD on scatterdot plots. GraphPad Prism was used for statistical analyses. The difference in means between two groups was assessed by the two-tailed Student’s t test (equal standard deviations) or Welch’s t test (unequal standard deviations). Differences in means among multiple groups were analyzed using a one-way or two-way ANOVA with treatment or time as the independent factor. When the ANOVA showed significant differences, pairwise comparisons between means were tested post hoc by the Bonferroni tests. In all analyses, p < 0.05 was considered statistically significant.