Mice

Tmem173 (Sting)-knockout (KO) mice (C57BL/6J background; Catalogue No. NM-KO-2105967) were obtained from the Shanghai Model Organisms Center, Zbp1-KO mice (C57BL/6J background; Strain No. T029037) were purchased from GemPharmatech (Nanjing, China). Wild-type (WT) C57BL/6J mice were provided by the Laboratory Animal Center of Sun Yat-Sen University. Age-matched male and female mice (6–8 weeks old) were randomly assigned to experimental groups. All mice were housed under a 12-hour light/dark cycle with ad libitum access to standard chow. All animal procedures were conducted in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research and were approved by the Institutional Animal Care and Use Committee of Zhongshan Ophthalmic Center, Sun Yat-Sen University (Approval No. Z2024115).

In vivo HSV-1 Infection and drug administration

Mice were anesthetized with an intraperitoneal injection of 1% sodium pentobarbital (70 µL/10 g body weight in normal saline). Intravitreal (IVT) injections were performed as previously described [32]. Briefly, mouse pupils were dilated with 1–2 drops of tropicamide-phenylephrine eye drops, and corneas were lubricated with hypromellose gel. HSV-1 (KOS strain) or PBS (vehicle control) was injected intravitreally (1 µL/eye) using a Hamilton microsyringe. For the mock infection, HSV-1 was first inactivated by incubating it at 100 °C for 1 h. For combination treatment, 10 mg of CBL0137 (Topscience) or quinacrine (MedChemExpress, USA) was dissolved in 5 mL of PBS via ultrasonication (37 °C, 1 min) and mixed with HSV-1 to achieve a final concentration of 2 mg/mL CBL0137 or quinacrine and 4 × 10⁴ PFU/mL HSV-1. The mixture was co-administered intravitreally (2 µL/eye). Control groups received equivalent volumes of PBS.

Optical coherence tomography (OCT), fundus imaging and Slit-lamp examination

After anesthesia and pupil dilation, retinal morphology was assessed using the Heidelberg Spectralis OCT system (Phoenix Micron IV) as previously described [32]. Fundus imaging was performed with the Micron IV retinal imaging system (Phoenix Research Laboratories). For fluorescein angiography, mice received an intraperitoneal injection of 2% fluorescein sodium (5 µL/g; Alcon Laboratories), and images were acquired immediately.

For slit-lamp examination, slit-lamp biomicroscope (Topcon Healthcare, SL-D701) equipped with a ×10–×16 magnification objective lens and adjustable slit width (0.1–2.0 mm) was used. A cobalt blue filter and diffuser were applied for enhanced visualization of corneal lesions. Light intensity was reduced to 30% of the maximum output to avoid phototoxicity. The slit beam was angled at 45°–60° to assess epithelial defects, stromal opacity, and neovascularization. Digital images were captured using a slit-lamp-mounted camera with consistent exposure settings (ISO 200, shutter speed 1/60 s). Mice received topical antibiotic ointment (Tobramycin) to prevent infection and were monitored until full recovery from anesthesia.

Single-Cell RNA sequencing (scRNA-seq) analysis

The raw data was obtained from our previous results (NCBI SRA database, accession: PRJNA1103951) [32]. Single-cell suspensions were processed using the 10X Genomics Chromium system. Sequencing data were analyzed using Seurat (v4.3.0) with the following parameters. Quality control: Cells with fewer than 200 or more than 9,000 detected genes or >15% mitochondrial reads were excluded. Normalization: the Log Normalize method (scale factor = 10,000) was applied to 2,000 highly variable genes. Doublet removal: doublets were identified and excluded using DoubletFinder (v2.0.3; expected rate = 10%).

Batch correction: principal component analysis (PCA; 20 PCs) and Harmony (v0.1.0) integration were applied. Clustering: the Louvain algorithm (resolution = 0.8) was used, followed by UMAP visualization. Annotation: cell identities were assigned using the CellMarker database [44]. Microglia/macrophages were identified by the co-expression of P2ry12, Cx3cr1, Aif1, and Cd68.Interferon-stimulated gene (ISG) expression (e.g., Slfn5, Igap1, Fndc3a) was analyzed using violin plots (Kruskal-Wallis test with Benjamini-Hochberg correction).

RNA sequencing (RNA-seq) and analysis

Total RNA from paired retinas was extracted using TRIzol™. Library preparation and sequencing were performed on an Illumina platform (Accession: PRJNA1244932). The following pipeline was used for data preprocessing. Adapter trimming: trim Galore (v1.18). Alignment: HISAT2 (v2.2.1; GRCm39 reference genome). Quantification: featureCounts (v2.0.1; FPKM). Differentially expressed genes (DEGs) were identified using DESeq2 (|fold change|≥ 2, FDR ≤ 0.05). Functional enrichment analysis was conducted using clusterProfiler.

Isolation and culture of bone marrow-derived macrophages (BMDMs)

BMDMs were aseptically isolated from the femurs and tibias of mice by flushing with cold PBS using a 25-gauge needle. Red blood cells were lysed with ACK lysis buffer (150 mM NH4Cl, 10 mM KHCO3, 0.1 mM EDTA, pH 7.4) for 2 min at room temperature, followed by centrifugation at 300 ×g for 5 min. The pellet was resuspended in complete BMDM medium (DMEM with 10% FBS, 1% penicillin/streptomycin, and 20 ng/mL recombinant M-CSF) and plated in non-tissue culture-treated Petri dishes. Cells were cultured at 37 °C with 5% CO2 for 7 days, with medium replaced on day 3. Differentiated BMDMs were detached with Accutase (Stemcell) on day 7 and re-plated for following experiments.

Isolation and culture of primary mouse microglia

Primary microglia (PMs) were isolated from postnatal day 1–3 (P1–P3) mouse pups. Following euthanasia, the cerebral cortices were dissected, mechanically minced, and digested in 0.125% (w/v) trypsin for 45 min at 37 °C. The cell suspension was filtered through a 70-µm nylon mesh and centrifuged at 300 × g for 5 min. Pelleted cells were resuspended in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin–streptomycin, and seeded into poly-L-lysine-coated T75 flasks. After 24 h of incubation at 37 °C in a humidified atmosphere containing 5% CO₂, the medium was replaced to remove non-adherent cells. Cultures were maintained with medium changes every 3 days until confluency was reached (~ 15 days). Microglia were detached by orbital shaking at 180 rpm for 2 h at 37 °C, collected by centrifugation, washed with phosphate-buffered saline (PBS), and replated for experiments at 5 × 10⁴ cells/cm².

Cell culture and treatmentThree murine ARN models

BMDMs were seeded in 12-well plates (2 × 10⁵ cells/well) and infected with HSV-1 (strain KOS; MOI = 10) for 24 h. For CBL0137 treatment, BMDMs were infected with HSV-1 (MOI = 10) for 2 h, washed with PBS, and then treated with 1 µM CBL0137 (MedChemExpress) for 6 h. PMs were seeded in 12-well plates at 2 × 10⁵ cells/well and infected with HSV-1 (MOI = 10) for 24 h. For drug treatment, PMs were infected for 2 h, washed with PBS, and subsequently treated with 1 µM CBL0137 for 12 h. BV2 cells were maintained in DMEM (10% FBS, 1% penicillin/streptomycin) at 37 °C with 5% CO2. Cells were treated with 20 µg/mL STING agonist DMXAA (Selleck) in combination with PBS, 10 µg/mL DNase I, or 100 U/mL RNase A for 6 h. Vero cells were cultured in Vero-specific medium and used for plaque assays to determine viral titers.

Live and dead cell assay

After treatment, cells were washed twice with PBS and stained with 1 µM Calcein-AM (live cells, green fluorescence) and 1 µM propidium iodide (PI) (dead cells, red fluorescence) in PBS for 20 min at 37 °C. Cells were gently washed with PBS and immediately imaged using a high-content imaging system (PerkinElmer Opera Phenix) with a 20× objective. Images were acquired for PI, Calcein-AM and bright field.

Plaque assay

Virus titers were determined by plaque assay on Vero E6 cells. Viral stocks were serially diluted 10-fold in DMEM containing 2% FBS. Vitreous humor samples (pooled from 3 to 4 eyes per sample) were collected with a microsyringe, clarified by centrifugation, and 10 µL was brought to 200 µL with DMEM prior adding to Vero cells. Cell culture supernatants were mixed 1:1 with DMEM prior to adding to Vero cells. Confluent Vero monolayers in 12-well plates (2 × 10⁵ cells/well, seeded 24 h prior) were washed with PBS and inoculated with 100 µL of diluted sample supplemented with 150 µL DMEM containing 2% FBS. After adsorption at 37 °C in 5% CO₂ for 2 h with gentle rocking every 15 min, the inoculum was removed and cells were overlaid with 2 mL plaque medium, prepared as a 1:1 (v/v) mixture of 2× minimum essential medium (MEM) and 2% (w/v) methylcellulose. After 72 h of incubation at 37 °C in 5% CO₂, monolayers were fixed with 4% paraformaldehyde (PFA) (500 µL/well, 1 h, room temperature) and washed three times with distilled water. Plaques were visualized by staining with 0.2% crystal violet in 20% methanol for 5 min at room temperature, followed by gentle rinsing. Distinct plaques were manually counted, and viral titers were expressed as plaque-forming units (PFU) per milliliter.

Histopathological scoring system

The scoring system was adapted according to previous publications [26, 45], as shown below.

Anterior Segment

0

Normal

 

1

Mild

Inffammatory cells but minimal HSV inclusions of iris and cilliary body (CB)

2

Moderate

Inffammation and few HSV inclusions of iris and CB, minimal necrosis

3

Severe

Signiffcant HSV inclusions cysts and/or necrosis of < 1/2 of iris or CB

4

Extreme

Profound HSV inclusions cysts and/or necrosis of > 1/2 of the iris or CB

Posterior Segment (Retinopathy)

0

Normal

Normal or injection artifact

1/2

Mild retinopathy

No HSV inclusions + retinal folds and/or vascular cufffng involving < 3/4 of section

1

Moderate retinopathy

Mild atypical retinopathy involving > 3/4 of section; or photoreceptor degeneration and mild retinal inffltration involving < 1/4 of section without necrosis or inclusions

2

Mild necrotizing retinitis

Focal HSV inclusions + partial-thickness necrosis involving < 1/4 of section

3

Moderate necrotizing retinitis

HSV Inclusions + full-thickness retinal necrosis involving 1/4 to 3/4 of the section

4

Severe necrotizing retinitis

HSV Inclusions + full-thickness necrosis involving the entire retina in the section

Immunocytochemistry

Sterile 12-mm round glass coverslips (Biosharp) were pre-placed in 24-well culture plates (Corning). After treatment, cells were washed twice with pre-warmed PBS and fixed with 4% PFA in PBS for 10 min at RT. Fixed cells were permeabilized with 0.5% Triton X-100 (vol/vol) in PBS (PBST) for 30 min at RT. Non-specific binding were blocked with 10% normal goat serum (Boster) in PBST for 30 min at RT. Primary antibodies were diluted in blocking buffer (1:200) and applied to coverslips overnight at 4 °C in a humidified chamber. After three 5-min PBS washes, cells were incubated Alexa Fluor®-conjugated secondary antibodies (1:500, Invitrogen) and 1 µg/mL DAPI (Sigma-Aldrich) for nuclear counterstaining for 2 h at RT. Images were acquired using an LSM980 confocal microscope (Carl Zeiss).

Hematoxylin and eosin (HE) staining and in situ terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assays

The experiments were conducted as previously described [32]. The enucleated eyeballs were fixed in FAS eye fixative overnight. Following fixation, the eyes were dehydrated in ethanol, cleared with xylene and then processed for paraffin embedding. Retinal paraffin sections, cut at a thickness of 10 μm along the superior and inferior retinal meridians, were used for subsequent experiments. The sections were dewaxed in xylene, rehydrated in a graded ethanol series, and then subjected to antigen retrieval by incubation in sodium citrate buffer (0.01 M, pH 6.0) at 95 °C for 20 min. The TUNEL assay was performed on the paraffin sections using the One Step TUNEL Apoptosis Assay Kit. Stained retinal sections were imaged using a TissueFAXS microscopy.

Immunofluorescence (IF) staining of cryosections and retinal flat mounts

The enucleated eyeballs were dissected in PBS to remove excess connective tissue. A small cut was made in the cornea of each eye prior to fixation in 4% PFA at RT for 30 min. The eyes were then cryoprotected in solutions of 15% sucrose in 0.1 M PBS for 1 h, followed by 30% sucrose at 4℃ overnight. The eyes were subsequently embedded in optimal cutting temperature medium (OCT). Retinal cryosections, cut at 10 μm thickness along the superior and inferior retinal meridians, were subjected to IF analysis as we previously described [12, 32]. Images were acquired using an LSM980 confocal microscope (Carl Zeiss).

IF analysis of retinal flat mounts was conducted as previously described [32]. Briefly, enucleated eye balls were fixed in 4% PFA for 5 min. Then retinas were dissected and fixed in 4% PFA for additional 30 min, and washed with PBS for three times. The retinas were permeabilized by 0.3% PBST (0.3% Triton X-100 in PBS) for 20 min, and blocked with 2.5% BSA (prepared in PBST) for 30 min. The retinas were then incubated with the primary antibody overnight at 4℃ and incubated with secondary antibodies for 2 h at RT. After washing with PBS, the retinas were mounted with Antifade Mounting Medium. Images were acquired using the LSM980 confocal microscope (Carl Zeiss, Germany).

Fluorescence imaging and intensity adjustment

For each IF image processing, exposure time and detector voltage were first adjusted using the corresponding isotype IgG control, and all experimental sections were subsequently imaged under identical conditions as their matched controls. Image contrast was standardized by adjusting the black and white thresholds in ZEN software (Zeiss, Germany) to ensure consistency across samples. All original ZEN image files have been uploaded to the https://figshare.com/s/f60d58db2ca44f84f7cc.

Flow cytometry analysis of retinal cells

Single-cell suspensions were prepared from freshly isolated mouse retinas by enzymatic–mechanical dissociation. Retinal tissues were digested in 2% (w/v) papain (Worthington Biochemical, USA) dissolved in cell strainer buffer (phosphate-buffered saline [PBS] supplemented with 1 mM EDTA and 2% fetal bovine serum [FBS]) for 20 min at 37 °C, with gentle trituration using fire-polished Pasteur pipettes every 5 min. Dissociated cells were filtered through a 100-µm nylon mesh, pelleted by centrifugation (1,000 × g, 10 min, 4 °C), and resuspended in cold PBS. Cells were fixed in 4% paraformaldehyde (PFA) for 10 min at room temperature (22–25 °C), followed by quenching with 0.1 M glycine for 5 min. After two washes in PBS, cells were resuspended in fluorescence-activated cell sorting (FACS) buffer (PBS containing 2% FBS and 0.1% sodium azide). Fc receptors were blocked using anti-mouse CD16/32 antibody (clone 93; BioLegend, USA) at 1:100 dilution for 10 min at room temperature. Cells were then stained with fluorophore-conjugated antibodies (Table S1) diluted in FACS buffer for 1 h at 4 °C under light-protected conditions. Prior to acquisition, cell suspensions were passed through a 40-µm cell strainer to ensure single-cell integrity. Flow cytometry was performed on a calibrated cytometer using compensation beads, acquiring ≥ 300,000 events per sample. Data were analyzed with FlowJo software (v10.9.0, BD Biosciences, USA).

Western blot (WB) analysis

Mouse retinas were homogenized in RIPA buffer with protease and phosphatase inhibitors. Protein lysates were processed using a high-speed tissue grinder, sonicated (EpiSonic 2000; amplitude: 60%, 3 s on/off for 1 min), and centrifuged at 12,000 g for 15 min at 4 °C. Supernatants were mixed with SDS sample buffer, heated at 95 °C for 10 min to denature the proteins. For WB analysis, 10–15 µg of total protein was used. Antibodies used are listed in the Table S1. The uncropped blots images were shown in Fig. S9.

Quantitative PCR (qPCR)

Genomic DNA was extracted from retinal tissues and cultured cells using the Genomic DNA Purification Kit (EZBioscience) according to the manufacturer’s protocol. Gene expression was quantified using ChamQ SYBR Color qPCR Master Mix (Vazyme) on a LightCycler® 480 System II (Roche). Each 10 µL reaction contained 10 ng of template DNA, 0.5 µM forward/reverse primers, and 1× PreMix. Conditions were as follows: 95 °C for 15 min (initial denaturation); 40 cycles of 95 °C for 10 s, 60 °C for 20 s, and 72 °C for 30 s; followed by melting curve analysis (65–95 °C, 0.5 °C/sec increment). Cycle threshold (Ct) values were normalized to the endogenous reference gene Actb (β-actin) using the 2−ΔΔCt method. All reactions were performed in triplicate (technical replicates), and results represent three independent biological experiments. The following primer sequences were used: mouse Actb (F: GCTCCTCCTGAGCGCAAG, R: CATCTGCTGGAAGGTGGACA), HSV-1 UL43 (F: TGGTATTGCCCAACACTTTCC, R: GCGCCAGGCACACACAT), HSV-1 ICP27 (F: TCCGACAGCGATCTGGAC, R: TCCGACGAGGAACACTCC).

Statistical analysis

Statistical analysis results are expressed as mean±SD. GraphPad Prism 9.5.1 software (GraphPad software, Inc., La Jolla, CA) was used for statistical analysis. Differences between two groups were analyzed using an unpaired t-test. Multiple-group comparisons were performed by one-way ANOVA or two-way ANOVA. P values less than 0.05 were considered statistically significant where, *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001.

Reagents, resources, and antibodies

The reagents, resources and antibodies are listed in Table S1.