1. INTRODUCTION

Autophagy is a key catabolic process that promotes cell survival by protecting cells from different types of stress. It plays an important role in cellular quality control and homeostasis under both normal and pathologic conditions.1 Autophagy activity is strongly linked to cardiovascular development and preservation of cardiac and vascular homeostasis, as well as the onset and progression of cardiovascular diseases (CVDs).2,3 Increasing evidence has shown that macrophage autophagy plays a crucial role in inflammation, apoptosis, and cholesterol efflux.4,5 This evidence suggests that the regulation of macrophage autophagy may be a potential strategy for CVD treatment.

Hyperglycemia is considered an independent risk factor for atherosclerosis and cardiovascular events6 and is a major risk factor for morbidity and mortality in diabetes mellitus (DM).7 Kanter et al8 have demonstrated that increased glucose availability enhances glucose flux and glycolysis in macrophages, causing inflammatory activation within these cells. This increase in inflammatory activation of macrophages is a hallmark of diabetes.

Exosomes are considered natural nanocarriers and intercellular messengers that regulate cell-to-cell communication. Exosomes play an important role in the induction of autophagic flux by transporting autophagy activators and/or autophagy-related molecules to target cells.9 The crosstalk between exosomes and autophagy may contribute to the maintenance of cellular homeostasis under external and internal stresses. Previous studies have shown that exosome-induced autophagy plays a pivotal role in cellular homeostasis, and may offer insight into novel therapeutic approaches.10,11

Long noncoding RNAs (lncRNAs) are non-protein-coding RNAs that are characterized by a length of at least 200 bp, with highly conserved sequences.12 Yang et al13 have reported that lncRNAs regulate autophagy via diverse mechanisms in eukaryotes. Furthermore, Wang et al14 have demonstrated that a lncRNA called autophagy-promoting factor regulates autophagy and myocardial infarction by functioning as a CeRNA sponge for miR-188-5p. This indicates that the lncRNA-microRNA-mRNA-CeRNA network may play a critical role in the regulation of autophagy. Metastasis-associated lung adenocarcinoma transcript 1 (MALAT1) is a highly conserved lncRNA whose expression correlates with autophagy and many human diseases. Fu et al15 demonstrated that MALAT1 activates autophagy and promotes cell proliferation by sponging miR-101 and upregulating STMN1, RAB5A, and ATG4D expression in glioma. Li et al16 also revealed that MALAT1 interacts with the RNA-binding protein human antigen R, and silencing of MALAT1 greatly enhances the post-transcriptional regulation of TIA-1, further inhibiting autophagy.

MALAT1 is significantly upregulated under hyperglycemic conditions and in fibrovascular membranes of the retina in patients with proliferative diabetic retinopathy.17 Liu et al18 demonstrated that MALAT1 promotes neovascularization in human retinal microvascular endothelial cells treated with high levels of glucose. MALAT1 gene polymorphisms have been shown to be associated with coronary artery disease in a Chinese population.19 More recently, MALAT1 has been reported to promote foot ulcer healing in diabetic rats.20 These data indicate that MALAT1 plays a crucial role in the relationship between hyperglycemia and vascular diseases.

MicroRNA (miRNA)-204 is a well-studied tumor suppressor. As a target of MALAT1, miR-204 regulates the expression of the autophagy marker LC3B in patients with acute kidney injury and in various types of cancer.21–24

Although macrophages express MALAT1, it is unclear whether macrophage MALAT1 affects autophagic activity under hyperglycemic conditions. In this study, we investigated the molecular regulatory mechanisms of macrophage-derived MALAT1 and autophagy under hyperglycemic conditions.

2. METHODS 2.1. Cell culture

Murine macrophages (RAW264.7) were originally obtained from American Type Culture Collection and cultured in Dulbecco’s modified Eagle’s medium (Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum (Gibco) at 37°C with 5% CO2. Cells were grown to 80% to 90% confluence in 100 mm culture dishes and subcultured at a ratio of 1:3. For exosome collection, 10 mL of cell-free supernatant from the macrophage culture was collected after treatment with 25 mM glucose for 1 hour.

2.2. Extraction of exosomes from cell media

Total Exosome Isolation Reagent (Invitrogen, Thermo Fisher Scientific, MA) was used to isolate exosomes from the cell culture media according to the manufacturer’s instructions as previously described.25 Exosomes were quantitated using ExoQuantTM quantification assay kit according to the manufacturer’s instructions (BioVision, Milpitas, CA).

2.3. Reverse transcription and real-time quantitative polymerase chain reaction

To quantitate MALAT1-exosome RNA transcripts, 12 μL of a 14 μL RNA eluate was subjected to reverse transcription (RT) with random hexamers using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Thermo Fisher Scientific, MA). For quantitative polymerase chain reaction (qPCR), 10% of each cDNA reaction was analyzed using standard SYBR chemistry and cycler conditions. The Fast SYBR® Green Master Mix (Applied Biosystems, Thermo Fisher Scientific) was used for the further assays. Polymerase chain reaction (PCRs) was performed in a 96-well plate using an ABI StepOnePlus cycler. The cycler profile is described as follows: (1) initial denaturation: 15 minutes at 95°C; (2) annealing and extension: 94°C for 15 seconds, 55°C for 30 seconds, 70°C for 30 seconds in reactions of 40 cycles. Analysis of relative gene expression levels was performed using formula 2−ΔCT with ΔCT = CT (target gene) − CT (control). Individual PCR products were sequenced to verify product purity as previously described.26

2.4. PCR product construction and sequencing

Cloning was performed using pGEM®-T Easy Vector System (Promega, Madison, WI). Ligation was performed in a final reaction volume of 10 μL consisting of 5 μL of 2X Rapid Ligation Buffer, 1 μL of pGEM®-T or pGEM®-T Easy Vector (50 ng), 1 μL of T4 DNA Ligase, and 3 μL of PCR product as described previously.25 Primers used for direct sequencing were identical to those used in the amplification reactions. The nucleotide sequences of both strands were determined using an ABI 3730 Genetic Analyzer (Applied Biosystems, Foster City, CA) equipped with a long-read sequencing capillary and POP-7 sequencing polymer.

2.5. Partial mouse MALAT1 DNA fragment (containing miR-204-5p binding site) construction

ENSMUST00000172812.2 _267–766 bp; Chromosome 19:5,795,690-5,802,672; http://www.ensembl.org/index.html was generated by artificial synthesis, digested with SacI and Xbal restriction enzymes, and ligated into the pmirNanoGLO plasmid vector (Promega). The cloned mouse MALAT1 DNA fragment contained miR-204-5p potential binding sites (from 517 to 539 bp). For the mutant, the conserved site AGGCATGAGTTGGAAACAGGGAA was mutated into CTTACGTATTGTGACCCCTTTCC and constructed using the same method described above. All cloned plasmids were confirmed by DNA sequencing (Seeing Bioscience Co., Ltd., Taipei, Taiwan).

2.6. Luciferase activity assay

The test plasmid (2 μg) was transfected using ViaFect™ Transfection Reagent (Promega) according to the manufacturer’s protocol as previously described.27 Briefly, a mixture of transfection reagent and DNA was incubated for 20 minutes at room temperature. The mixture was added to the cell culture medium for 24 hours. The culture medium was then replaced with normal culture medium. Following treatment, cell extracts were prepared using the Nano-Glo dual-luciferase reporter assay system (Promega), and luciferase activity was measured using a luminometer (Glomax Multi Detection System, Promega).

2.7. Western blot analysis

Cultured macrophages were harvested by scraping and centrifuged (300×g) for 10 minutes at 4°C. The pellet was resuspended and homogenized in RIPA Lysis and Extraction Buffer (Thermo Fisher Scientific, Rockford, IL) and centrifuged at 14 000×g for 15 minutes. A Bio-Rad Protein Assay was used to measure protein content. Equal amounts of protein (30 μg) were loaded onto 10% sodium dodecyl sulfate-polyacrylamide gels, and subjected to electrophoresis. Western blot was performed as previously described.25 Equal protein loading of the samples was further verified by quantifying β-actin levels using mouse monoclonal β-actin (Sigma-Aldrich, Saint Louis, MO). All western blots were quantified using densitometry. Cells treated with rapamycin (Sigma-Aldrich), an autophagy inducer and 3-methyladenine (3-MA; Sigma-Aldrich), an autophagy inhibitor were used as positive and negative controls, respectively.

2.8. Balloon injury of the carotid artery in diabetic rats and delivery of exosomes containing macrophage-derived MALAT1

Male Wistar rats (300-320 g), aged 18 weeks, purchased from BioLASC (BioLASC Taiwan Co., Ltd., Taipei, Taiwan), were injected with a single dose of intraperitoneal streptozotocin (STZ, Sigma-Aldrich) at 60 to 120 mg/kg to induce diabetes. Diabetes was confirmed by the presence of hyperglycemia (blood glucose concentration of 19 mmol/L) for a minimum of 1 week. One week after STZ injection, the rats were anesthetized with isoflurane (2%) and subjected to balloon catheter injury in the right carotid artery as previously described.28 At the end of the experiment, the rats were euthanized with carbon dioxide using a special acrylic box and high-pressure barreled carbon dioxide equipment. Rats were placed in the box and subjected to a low concentration of carbon dioxide at first. Then, the carbon dioxide levels were increased rapidly so that the rat quickly lost consciousness. We continued to perfuse the gas for at least 5 minutes after the rat was lost consciousness and confirmed death before removing the rat from the euthanasia container. Immunofluorescence staining was performed as described previously.28 The intimal, medial, and adventitial cross-sectional areas were measured using imaging software (Nikon NIS-Elements, Tokyo, Japan). All animal experiments were approved by the Institutional Animal Care and Use Committee of Shin Kong Wu Ho-Su Memorial Hospital (approval number: 1110MOST002) and were performed in accordance with the Guide for the Care and Use of Laboratory Animals.

2.9. Statistical analysis

The data are expressed as mean ± SD. Statistical significance was determined by analysis of variance (ANOVA) (GraphPad Software Inc., San Diego, CA). The Tukey-Kramer comparison test was used for pairwise comparisons between multiple groups after ANOVA. Statistical significance was set at p < 0.05.

3. RESULTS 3.1. High glucose stimulation induced MALAT1 expression in cultured macrophages

To test the effect of glucose stimulation on MALAT1 expression in macrophages, different concentrations of glucose were added to the culture medium for 1 hour. As shown in Supplementary Fig. 1A, https://links.lww.com/JCMA/A250, MALAT1 was significantly upregulated in the presence of 12.5 to 100 mM glucose. We found that 25 mM glucose treatment induced the maximal effect on MALAT1 expression, after which its expression gradually decreased and reached a level similar to that of the control after 6 hours (Supplementary Fig. 1B, https://links.lww.com/JCMA/A250). Therefore, 25 mM glucose treatment was used for subsequent experiments.

Thus, exosomes were isolated from macrophages treated with 25 mM glucose. These glucose-treated macrophage-derived exosomes significantly enhanced cytoplasmic MALAT1 expression in a dose-dependent manner compared to control cells or cells treated with exosomes derived from control macrophages (data not shown). Exosomes derived from macrophages stimulated with 25 mM glucose did not induce significant cytotoxicity when compared with the control.

3.2. Glucose-treated macrophage-derived exosomes decreased miR-204-5p and increased LC3B expression in cultured macrophages

MALAT1 has been shown to sponge miR-204-5p in other cell types.21–23 The exogenous addition of 50 µg of exosomes induced maximal reduction of cytoplasmic miR-204-5p expression (Fig. 1). The same amount of control exosomes did not reduce miR-204-5p expression. Therefore, 50 µg of exosomes derived from macrophages treated with 25 mM glucose were used for subsequent experiments.

Fig. 1:

Levels of miR-204-5p in macrophages treated with different amounts of exogenous macrophage-derived exosomes for 3 h. The macrophage-derived exosomes were extracted from macrophages treated with 25 mM glucose for 1 h. *p < 0.05 vs control; **p < 0.01 vs control. N = 6 per group.

Treatment with 50 µg of glucose-treated macrophage-derived exosomes significantly enhanced cytoplasmic MALAT1 levels in macrophages. However, cytoplasmic miR-204-5p mRNA levels were significantly reduced after treatment with exosomes from macrophages that weren’t treated with glucose. Cytoplasmic LC3B levels exhibited a similar pattern to that of MALAT1 after treatment with glucose-treated macrophage-derived exosomes (Fig. 2). Macrophage-derived exosomes gradually upregulated LC3B protein expression from 1 to 6 hours, with LC3B expression peaking at 5 hours (Fig. 3A, B). Silencing MALAT1 using MALAT1 siRNA significantly reduced cytoplasmic LC3B expression induced by glucose-treated macrophage-derived exosomes. Scrambled MALAT1 siRNA did not significantly influence LC3B expression following treatment with macrophage-derived exosomes. Overexpression of wild-type miR-204-5p was significantly inhibited by macrophage-derived exosome-induced LC3B expression, whereas overexpression of mutant miR-204-5p or its antagomir did not affect macrophage-derived exosome-induced LC3B expression. Treatment with rapamycin (an autophagy inducer) and 3-MA (an autophagy inhibitor) significantly increased and decreased LC3B expression compared to that in the control, respectively (Fig. 3C, D). Treatment with macrophage-derived exosomes, wild-type miR-204-5p, mutant miR-204-5p, or rapamycin increased the development of autophagosomes and/or autolysosomes in macrophages, as shown by DALGreen fluorescent dye staining (Fig. 3E). Silencing MALATA1 using MALAT1 siRNA significantly reversed cytoplasmic miR-204-5p expression in macrophages (Fig. 4A). Treatment with scrambled MALAT1 siRNA did not significantly influence cytoplasmic miR-204-5p expression following treatment with macrophage-derived exosomes. Exosomes derived from macrophages stimulated with 25 mM glucose significantly enhanced the LC3B expression (Fig. 4B). MALAT1 siRNA significantly inhibits LC3B mRNA expression in macrophages treated with macrophage-derived exosomes. Scrambled MALAT1 siRNA did not significantly affect LC3B mRNA expression following macrophage-derived exosome treatment. Overexpression of wild-type miR-204-5p significantly inhibited LC3B expression induced by macrophage-derived exosomes, while overexpression of the mutant miR-204-5p or the antagomir of miR-204-5p did not inhibit LC3B expression induced by macrophage-derived exosomes. Rapamycin, and 3-MA treatment significantly increased and decreased LC3B expression compared to that in the control, respectively (Fig. 4A, B). These results indicate that macrophage-derived exosome stimulation enhanced MALAT1 expression but reduced miR-204-5p expression to increase LC3B protein levels in macrophages under hyperglycemic conditions.

Fig. 2:

Effect of macrophage-derived exosome on cytoplasmic MALAT1, LC3B, and miR-204-5p expression in cultured macrophages treated with exogenous macrophage-derived exosomes for different periods of time. The macrophage-derived exosomes were extracted from macrophages treated with 25 mM glucose treatment for 1 h. *p < 0.01 vs control. N = 4 per group.

Fig. 3:

Effect of macrophage-derived exosomes on LC3B protein expression in cultured macrophages. A, Representative western blots for LC3B and β-actin from macrophages subjected to macrophage-derived exosome treatment for different periods of time. B, Quantitative analysis of LC3B protein levels. The values for stimulated macrophages have been normalized to the control cell values. *p < 0.01 vs control; **p < 0.05 vs control. N = 3 per group. C, Representative western blots for LC3B and β-actin levels in macrophages treated with different amounts of macrophage-derived exosomes. D, Quantitative analysis of LC3B protein levels. The values for the stimulated macrophages have been normalized to the control cell values. Scramble siRNA was the control siRNA. *p < 0.01 vs control; **p < 0.05 vs control. N = 3 per group. E, Representative image of autophagosomes and/or autolysosomes by DALGreen fluorescent dye stain in macrophages treated with different agents. Treatment with macrophage-derived exosomes, wild-type miR-204-5p, mutant miR-204-5p, and rapamycin increased DALGreen fluorescent dye labeling. Similar results were observed in another two experiments.

Fig. 4:

Effect of macrophage-derived exosomes on miR-204-5p and LC3B expression in cultured macrophages. A, Quantitative real-time PCR analysis of miR-204-5p levels. Values for the treated macrophages are expressed as a ratio of the values normalized with miR-204-5p in the control cells. *p < 0.01 vs control. N = 4 per group. B, Quantitative real-time PCR analysis of LC3B mRNA levels. Values for the treated macrophages are expressed as a ratio of the values normalized values with LC3B mRNA in the control cells. Scrambled siRNA was the control siRNA. Macrophage-derived exosomes were extracted from macrophages treated with 25 mM glucose treatment for 1 h. *p < 0.01 vs control; **p < 0.01 vs Exosome. N = 4 per group.

3.3. MiR-204-5p decreased MALAT1 and LC3B luciferase activity in macrophages treated with macrophage-derived exosomes under high glucose stimulation

Fig. 5A shows the sequence of the MALAT1 3’UTR target site for miR-204-5p binding (nucleotides 517-539). MiR-204-5p overexpression significantly reduced MALAT1 luciferase activity in macrophages under 25 mM high glucose stimulation, when miR-204-5p was bound to the normal MALAT1 3’UTR (Fig. 5B). Overexpression of the mutant miR-204-5p did not significantly influence MALAT1 luciferase activity, indicating that miR-204-5p was a target of MALAT1. We discovered that the LC3B 3’UTR (nucleotides 387-408) had a binding site for miR-204-5p, as indicated in Fig. 5C. MiR-204-5p overexpression significantly reduced LC3B luciferase activity in macrophages under 25 mM high glucose stimulation when miR-204-5p was bound to the normal LC3B 3’UTR (Fig. 5D). Overexpression of mutant miR-204-5p did not significantly influence LC3B luciferase activity, indicating that LC3B is a miR-204-5p target gene.

Fig. 5:

Effect of miR-204-5p on MALAT1 and LC3B luciferase activity in cultured macrophages treated with macrophage-derived exosomes. A, Sequence of the mouse miR-204-5p binding site in the MALAT1 3’UTR (nucleotides 517-539 bp). B, MALAT1 3’UTR luciferase activity after treatment with macrophage-derived exosomes treatment for 3 h with wild-type or mutant MALAT1. C, Sequence of the miR-204-5p binding site in the mouse LC3B 3’UTR, which is located on the miR-204-5p 3’UTR (nucleotides 387-408 bp). D, LC3B 3’UTR luciferase activity after treatment with macrophage-derived exosomes treatment for 3 h with wild-type or mutant LC3B. N = 3 per group.

3.4. Carotid artery balloon injury enhances MALAT1 to inhibit miR-204-5p expression in diabetic rats

Single doses of STZ (60-120 mg/kg) were administered to induce diabetes. Streptozotocin (90 mg/kg) induced the maximal effect on increased fasting glucose levels in rats (Supplementary Figure II, https://links.lww.com/JCMA/A251) for up to 4 weeks. Thus, this dosage (90 mg/kg) was administered in the subsequent animal studies. The results showed that MALAT1 expression in the carotid arterial tissue gradually increased from 3 to 28 days in diabetic rats compared with that in control rats, and in diabetic rats after carotid artery balloon injury compared with that in the sham group (Fig. 6A). MALAT1 mRNA expression was significantly enhanced and miR-204-5p expression was significantly reduced between days 7 and 28 post balloon injury of the carotid artery in diabetic rats (Fig. 6B). The expression pattern of LC3B mRNA in the carotid artery after balloon injury was similar to that of MALAT1 mRNA. Fourteen days after balloon injury of the carotid artery, miR-204-5p expression was significantly inhibited in diabetic rats treated with glucose-treated macrophage-derived exosomes. At 14 days after balloon injury to the carotid artery, miR-204-5p expression was significantly reversed by silencing MALAT1 using a MALAT1 siRNA (Fig. 7A). Scrambled MALAT1 siRNA did not significantly influence miR-204-5p expression compared to diabetic rats with balloon injury. Fourteen days after balloon injury of the carotid artery, LC3B mRNA and protein expression was significantly enhanced by treatment with macrophage-derived exosomes and significantly; however it was reduced by silencing MALAT1 using MALAT1 siRNA and miR-204-5p wild-type overexpression compared to that in injured rats treated with glucose-treated macrophage-derived exosome (Fig. 7B–D). Overexpression of scrambled siRNA or mutant miR-204-5p did not significantly influence LC3B mRNA and protein expression compared to that in the injured, glucose-treated macrophage-derived exosome group.

Fig. 6:

Effect of carotid artery balloon injury on MALAT1 expression in diabetic rats. A, Quantitative real-time PCR analysis of MALAT1 levels after different time-periods in arterial tissue with or without balloon injury in diabetic rats. B, Quantitative real-time PCR analysis of MALAT1, miR-204-5p, and LC3B mRNA levels after different time-periods in arterial tissue after carotid artery balloon injury. *p < 0.01 vs control; **p < 0.05 vs control. N = 5 per group.

Fig. 7:

Macrophage-derived MALAT1-mediates the reduction of miR-204-5p expression after balloon injury of the carotid artery in diabetic rats. A, Quantitative real-time PCR analysis of miR-204-5p levels in arterial tissue 14 d after balloon injury of the carotid artery in diabetic rats. The macrophage-derived exosomes were extracted from macrophages treated with 25 mM glucose for 1 h. Scrambled siRNA was the control siRNA. B, Quantitative real-time PCR of LC3B mRNA levels in arterial tissue 14 d after balloon injury of the carotid artery in diabetic rats. Macrophage-derived exosomes were extracted from macrophages treated with 25 mM glucose for 1 h. *p < 0.01 vs exosome group. C, Representative western blots for LC3B and β-actin levels in arterial tissues 14 d after balloon injury of the carotid artery in diabetic rats. D, Quantitative analysis of LC3B levels. The values for the balloon injury group have been normalized to those of the sham group. *p < 0.05 vs balloon injury in diabetic rats. N = 5 per group.

3.5. Macrophage-derived exosomes enhanced LC3B protein expression in the arterial tissue of diabetic rats after carotid artery balloon injury

Fourteen days after carotid artery balloon injury, LC3B fluorescent signals were enhanced in the arterial tissues of diabetic rats. LC3B fluorescence signals were also enhanced upon treatment with macrophage-derived exosomes (Supplementary Figure III, https://links.lww.com/JCMA/A252). LC3B fluorescent signals were reduced by silencing MALAT1 using MALAT1 siRNA at 14 days after balloon injury of the carotid artery compared to the group treated with macrophage-derived exosome after balloon injury of the carotid artery. Balloon injury to the carotid artery significantly reduced lumen size and intimal area gain of the carotid artery. Treatment with macrophage-derived exosomes significantly reduced lumen size and intimal area gain compared to that in the group administered balloon injury of the carotid artery. Lumen size was significantly increased, and intimal area was significantly reduced by siRNA-mediated silencing of MALAT1 compared with diabetic rats administered balloon injury of the carotid artery (Supplementary Fig. IV, https://links.lww.com/JCMA/A253).

4. DISCUSSION

During circulation, exosomes are the richest reservoirs of almost all lncRNAs, which are thus protected against RNases. These protected circulating lncRNAs contain valuable genetic information, making them more useful than body fluids in clinical applications.29–31 Increasing evidences suggest that manipulating lncRNAs may serve as novel therapeutic tools and innovative biomarkers for the diagnosis and treatment of related diseases.

A clinical study has demonstrated that patients with diabetes exhibit a higher risk of atherosclerotic CVD and its associated morbidity and mortality.32 Macrophages play an important role in the pathogenesis of atherosclerosis and vascular disease.33 LncRNAs have been reported to exacerbate atherosclerosis and vascular disease34 and MALAT1 plays a causal role in the pathophysiological process associated with complications caused by DM.35

Previous studies have demonstrated that MALAT1 acts as a sponge for miR-204-5p in lung adenocarcinoma, gastric cancer, thyroid cancer cells, and acute kidney injury.21–24 In this study, we showed that MALAT1 reduces miR-204-5p expression in macrophages under high glucose stimulation. We also identified an miR-204-5p binding site in the MALAT1 promoter. Exosomes from macrophage stimulated with 25 mM glucose for 1 hour expressed MALAT1. Moreover, the exogenous addition of glucose-treated macrophage-derived exosomes inhibited miR-204-5p expression. Moreover, siRNA-mediated silencing of MALAT1 reversed miR-204-5p expression.

LC3B, a ubiquitin-like molecule, is an autophagy marker36 and an RNA-binding protein that induces rapid mRNA degradation during autophagy.37 Recently, Miao et al38 reported that treatment with high levels of glucose increased LC3B expression and the quantity of autophagic vacuoles in rat aortic endothelial cells. LC3B was found to be a target of miR-204 in osteoblastic MC3T3-E1 cells.39 However, it is not known whether treatment with high levels of glucose increases autophagy in macrophages and in an animal model of carotid artery vascular injury. In this study, we revealed that macrophage-derived exosomes containing MALAT1 could bind to miR-204-5p to enhance LC3B expression, and that silencing MALAT1 could significantly attenuate the effect of exosome treatment. Overexpression of miR-204-5p significantly altered the effect of macrophage-derived exosomes via silencing of MALAT1. We identified an miR-204-5p binding site in the 3’UTR of LC3B, and the overexpression of miR-204-5p significantly reduced LC3B luciferase activity in macrophages following exosome treatment. These results indicate that LC3B is a target gene of miR-204-5p. Shao et al22 have reported that MALAT1 activates autophagy by downregulating miR-204 expression in gastric cancer. Zhang et al40 have reported that miR-204 silencing could reduce mitochondrial autophagy in a murine Alzheimer’s model. In this study, we compared effect of MALAT1 and miR-204-5p on autophagy with that induced by rapamycin and 5-MA, which act as an autophagy inducer and inhibitor, respectively.

Our in vivo balloon injury carotid artery model also demonstrated that macrophage-derived MALAT1 enhanced balloon injury-induced plaque formation in carotid arterial tissue of diabetic rats. Our results demonstrated that miR-204-5p expression was reduced and LC3B expression was enhanced by balloon injury of the carotid artery in diabetic rats. We also found that miR-204-5p expression was reduced and LC3B expression was enhanced by treatment with macrophage-derived exosomes in diabetic rats that were administered balloon injury to the carotid artery. siRNA-mediated silencing of MALAT1 reversed miR-204-5p expression and inhibited LC3B expression in the carotid artery after balloon injury. Balloon injury to the carotid artery results causes lumen size to decrease and intimal area to increase. However, MALAT1 silencing or miR-204-5p overexpression increased lumen size and reduced intimal area of the carotid artery after balloon injury. Although we did not analyze human samples, Lu et al24 reported that MALAT1 was strongly elevated, and miR-204 was significantly reduced in serum samples from patients with acute kidney injury.

The effect of MALAT1 on autophagy in different diseases or cell types is an issue of debate. MALAT1 has been shown to activate autophagy to promote tumor progression in glioma,15 pancreatic cancer,16 gastric cancer,22 and multiple myeloma.41 However, Wang et al42 have reported that MALAT1 promotes gastric cancer progression via inhibition of autophagy. Miao et al38 have reported that treatment with high levels of glucose increases LC3B expression and enhances autophagy in rat aortic endothelial cells.34MALAT1 was also shown to enhance ox-LDL-induced autophagy in macrophages.43 Our study results revealed that hyperglycemia upregulated MALAT1 expression and LC3B, an autophagy marker, in both macrophages and diabetic rats after balloon injury of the carotid artery. However, Yang et al44 reported that impaired autophagy was observed in high glucose-stimulated H9C2 cells and heart tissue from diabetic patients. Analysis of the effect of MALAT1 on different cell types and disease models may help us understand these seemingly contradictory reports on MALAT-mediated activation and inhibition of autophagy.

Macrophages exhibit different phenotypes in response to different stimuli with M1 and M2 macrophages exhibiting pro- and anti-inflammatory functions, respectively.45 Recently, Ahmad et al46 have shown that MALAT1 favors the M1 macrophage because MALAT1 knockdown enhanced the expression of M2 macrophage markers without affecting M1 macrophage markers. Based on the findings of this study, we speculate that macrophage in this study exhibited the M1 phenotype because macrophage MALAT1 promotes vascular disease in the carotid artery balloon injury model.

To conclude, in the present study, we found that hyperglycemia upregulated MALAT1 to inhibit miR-204-5p expression, thereby increasing LC3B expression in macrophages and promoting vascular disease. The effects of hyperglycemia on MALAT1, miR-204-5p, and LC3B expression in macrophages are summarized in Fig. 8. Thus, we hypothesized that macrophage-derived exosomal MALAT1 stimulated cellular autophagy response and that targeting the MALAT/miR-204-5p axis may have applications in treating hyperglycemia-induced vascular diseases, including diabetic retinopathy, diabetic foot ulcers, and diabetes-associated vascular diseases. Macrophage-derived exosomal MALAT1 may serve as a novel cell-free approach for the management of vascular diseases frequently encountered in patients with DM.